Journal Archive

Journal of Physiology & Pathology in Korean Medicine - Vol. 36 , No. 5
[Paper List] [Go to Volume List]

[ ORIGINAL ARTICLES ]
Journal of Physiology & Pathology in Korean Medicine - Vol. 36, No. 5, pp. 187-192
Abbreviation: J Physiol & Pathol Korean Med
ISSN: 1738-7698 (Print) 2288-2529 (Online)
Print publication date 25 Oct 2022
Received 16 Aug 2022 Revised 21 Oct 2022 Accepted 25 Oct 2022
DOI: https://doi.org/10.15188/kjopp.2022.10.36.5.187

한방 복합물이 피부 염증 및 아토피 피부염에 미치는 영향
최지희 ; 주인환 ; 박종민 ; 김동희*
대전대학교 한의과대학 병리학교실

Effects of Herbal Medicine Complex on Skin Inflammation and Atopic Dermatitis
Ji-Hee Choi ; In-Hwan Joo ; Jong-Min Park ; Dong-Hee Kim*
Department of Pathology, College of Korean Medicine, Daejeon University
Correspondence to : Dong-Hee Kim, Department of Pathology, College of Korean Medicine, Daejeon University, Daejeon 34520, Republic of Korea ·E-mail : dhkim@dju.kr ·Tel : +82-42-280-2623


Ⓒ The Society of Pathology in Korean Medicine, The Physiological Society of Korean Medicine
Funding Information ▼
Abstract

The purpose of this study is to examine the effect of herbal medicine complex (HMC) containing Camellia sinensis L., Duchoesna chrysantha, Houttuynia cordata Thunberg, Poncirus trifoliata Rafinesque on skin inflammation and atopic dermatitis. First, we examined the anti-inflammatory effect of HMC in TNF-α induced human keratinocytes (HaCaT cell). Real-time PCR and western blotting were performed to evaluate the expression of inflammatory cytokines (e.g., iNOS, COX-2, IL-6, IL-8) mRNA and protein. Four-weeks old male NC/Nga mice were treated with 1% 2,4-dinitrochlorobenzene (DNCB) solution and used as an atopic dermatitis mice model. And, HMC (200 mg/kg or 400 mg/kg) was administered directly into the stomach of mice for 4 weeks, and blood or serum analysis, tissue staining were performed after oral gavage. As a result HMC inhibited the mRNA expression of iNOS, COX-2, IL-6, and IL-8, which had been increased by TNF-α in HaCaT cells. In addition, the protein expression was also significantly suppressed in the same way as the mRNA expression results. The in vivo experiment results showed that, HMC administration reduced thickening of the epidermis and infiltration of eosinophil into the skin stratum basale compared to DNCB treatment. In addition, HMC administration significantly reduced the inflammatory cytokines (IL-4, IL-5, IL-6, and IL-13) production and immunocyte (white blood cell, lymphocyte, neutrophil, and eosinophil) count compared to DNCB treatment. Moreover, the serum IgE and histamine level was decreased by HMC administration. These results suggest that HMC can be used as effective herbal medicine extract for skin inflammation and atopic dermatitis. And this study may contribute to the development of the herbal medicine-based drug for the treatment of skin inflammation and atopic dermatitis.

Keywords: Herbal medicine complex, HaCaT, Skin inflammation, NC/Nga, Atopic dermatitis
서 론

아토피 피부염(atopic dermatitis)은 습진성 병변, 가려움증, 발적 등의 증상이 특징인 만성 염증성 피부질환이다. 사회의 발전이 가속화됨에 따라 다양한 외인성 항원들이 늘어나고 있어 지난 몇 년 동안 아토피 피부염 유병률은 지속적으로 증가 추세로 보고되고있다1,2). 외부자극에 의해 가려움증이 유발되어 긁게 되고, 이러한 행동이 지속되면 피부 장벽의 손상과 염증 반응을 야기하게 되며, 염증 반응은 다시 가려움증을 유도하기때문에 아토피 피부염을 악화시키는 원인이 된다3,4).

아토피 피부염의 발병기전은 아직 명확하게 밝혀지지 않았으나 피부장벽을 구성하는 핵심 단백질인 필라그린(filaggrin) 유전자의 돌연변이에 의한 유전학적 요인과 T helper cell type 1(Th1) 및 Th2의 불균형으로 인해 Immunoglobulin E(IgE)의 생성 및 면역세포의 활성이 증가되는 면역학적 요인으로 구분할 수 있다5-7).

현재 아토피 피부염에 사용되고 있는 치료제들 중 가장 흔히 사용되는 덱사메타손(dexamethasone)은 코르티코스테로이드제로서 면역반응을 억제하여 피부 염증 반응을 감소시킨다. 이 외에도 가려움증을 개선하기 위해 사용되는 항히스타민제와 피부 염증 반응을 개선하기 위한 면역조절제등이 사용되고 있으며, 최근에는 면역 활성화를 유도하는 면역매개물질을 억제하여 아토피 피부염을 치료하는 생물학적 제제도 개발되었다8). 아토피 피부염은 일시적인 치료로 완치되는 질병이 아닌 만성질환으로 장기적이고 지속적인 치료가 요구되며, IgE에 의해 매개된 알레르기 과민반응의 치료에 사용되는 코르티코스테로이드를 장기간 사용하면 피부 위축, 색소 변화, 피부 궤양 등의 피부 부작용을 야기하므로 부작용이 적은 천연물 개발에 관심이 많은 추세이다9).

한의학에서 아토피 피부염은 奶癬, 浸淫瘡, 旋耳風, 四彎風, 濕瘡, 濕疹, 胎瘡, 胎熱 등의 범주에 속한다10). 醫宗金鑑∙外科心法要玦에서는 四彎風을 기술하면서 “彎曲된 피부 부위에 발생하고 瘙痒症이 매우 심하며 긁었을 때 삼출물이 나와 마치 濕癬과 같다”라고 표현하였으며, 상기한 질환에서도 비슷한 증상들이 아토피 피부염과 가장 유사하게 표현되고 있다10).

아토피 피부염 개선에 대한 새로운 천연물 유래 소재를 찾기 위해 천연물들의 혼합을 통해 단일 천연물의 효능보다 우수한 효능을 나타낸다는 선행 연구들11-13)에 착안하여 항염증 및 항산화 효능과 더불어 아토피 피부염에 대한 효능이 확인된 녹차(Camellia sinensis L.)14,15), 사매(Duchoesna chrysantha)16,17), 지실(Poncirus trifoliata Rafinesque)18,19)과 항염증 및 알레르기성 염증 질환에 대한 효능이 규명된 어성초(Houttuynia cordata Thunberg)20-22)를 혼합하여 천연물 복합물(Herbal Medicine Complex, HMC)을 개발하였다.

이에 본 연구에서는 인간 유래 각질형성세포주인 HaCaT 세포에 염증 반응을 유도하고 HMC을 처리하여 염증 반응 개선에 대한 효과를 확인하였으며, 2,4-dinitrochlorobenzene(DNCB)로 아토피 피부염 병태가 유도된 마우스모델에 HMC을 경구투여하고 혈액 및 조직학적 분석을 진행하여 유의적인 결과를 도출하였기에 보고하는 바이다. 또한 이를 바탕으로 피부 염증 반응 및 아토피 피부염 개선에 대한 HMC의 사용가능성을 제고하고자 한다.

재료 및 방법
1. 재료

본 연구에 사용된 HMC는 한약재 유통업체인 (주)옴니허브에서 검수된 한약재를 구입하여 사용하였으며, 각 처방의 구성은 아래와 같다(Table 1).

Table 1. 
The prescription of HMC
Herbal name Scientific name Origin Weight(g)
綠茶 Camellia sinensis L. Korea 4
蛇苺 Duchoesna chrysantha Korea 4
魚腥草 Houttuynia cordata Thunberg Korea 4
枳實 Poncirus trifoliata Rafinesque Korea 4
Total amount 16

2. 시료 추출

5첩 분량의 HMC(80 g)에 1 L의 증류수를 넣고 100℃에서 3시간동안 추출하였으며, 여과지를 사용하여 추출물을 여과하였다. 여과된 추출물은 rotary vacuum evaporator를 사용하여 감압농축하고 freeze dryer를 사용하여 동결건조를 진행하였다. 동결건조 완료 후, HMC는 21.37 g(수득률 : 26.71%)의 분말을 획득하였고 –20℃에 보관하면서 실험 당일 소분하고 증류수에 용해시켜 사용하였다.

3. 지표성분 분석

HMC는 20 mg/ml 농도로 증류수에 용해시키고 0.45 ㎛ membrane filter로 여과하여 분석용 시료로 사용하였다. 분석 시 이동상은 water(A)와 acetonitrile(B)로 gradient elution system을 적용시켜 0~20분(95% A, 5% B), 20~30분(75% A, 25% B), 30~40분(70% A, 30% B), 40~50분(100% B)로 설정하였다. 유속은 1 ml/min, column 온도는 30℃를 유지하였고, UV wavelength는 254 nm로 설정하여 HMC 내 지표성분들을 분석하였다. 분석에 사용한 hesperidin, lupeol, gallic acid, chlorogenic acid, caffeic acid, epigallocatechin-3-gallates는 Sigma-Aldrich (USA)에서 구입하였으며, high performance liquid chromatography (SHIMADZU, Japan)를 사용하여 분석하였다.

4. 세포 배양

사람 유래 각질형성세포인 HaCaT cell은 한국 세포주 은행(Korean Cell Line Bank; KCLB)에서 구입하였고 10%의 fetal bovine serum(FBS; Welgene, Korea)가 추가된 dulbecco′s modified eagle′s medium(DMEM; Welgene, Korea)배지를 사용하였으며, 내부 온도는 37℃, CO2 농도는 5%로 유지되는 세포배양기에서 배양하였다.

5. 세포 생존율 측정

HaCaT cell을 48 well plate에 2×104 cells/well로 분주하여 배양하였으며, 24시간 후, HMC를 다양한농도(50, 100, 200, 400 μg/ml)로 처리하여 다시 24시간 배양하였다. 모든 배양이 종료된 후, 각 well당 20 μl의 EZ-Cytox(DoGenBio, Korea) 용액을 첨가하여 세포배양기에서 30분간 반응시켰다. 반응 후 microplate reader(Molecular Devices, USA)의 450 nm에서 흡광도를 측정하였으며, 세포생존율은 대조군에 대한 백분율로 표시하였다.

6. 유전자 발현량 측정

HaCaT cell을 6 well plate에 2×105 cells/well로 분주하여 배양하였으며, 24시간 후, HMC를 50, 100, 200 μg/ml로 1시간동안 전처리한 후, human TNF-α(Sigma-Aldrich, USA)를 20 ng/ml로 처리하여 24시간 동안 배양하였다. 모든 배양이 종료된 후, 원심분리하여 얻은 세포는 total RNA prep kit를 사용하여 RNA를 추출하였으며, 추출한 RNA는 reverse transcription premix와 혼합하고 PCR cycler를 사용하여 45℃에서 60분, 95℃에서 5분간 반응을 통해 cDNA를 합성하였다. 합성된 cDNA로부터 특정 유전자를 증폭시켜 확인하기 위해 real-time PCR을 진행하였으며, cDNA와 특정 유전자에 맞는 primer, SYBR green premix(BIONEER, Korea)를 혼합하여 95℃에서 5분 동안 반응시키고 95℃에서 5초, 60℃에서 30초를 40회 반복하여 특정 유전자를 증폭시켰다. 유전자 발현량은 대조군의 유전자 발현량을 기준으로 상대정량 하였으며, 사용된 primer들의 정보는 Table 2와 같다.

Table 2. 
Real-Time PCR Primer Sequences
Primer Size(bp) F/R Sequences
iNOS 81 F AGGTCCAAATCTTGCCTGGG
R ATCTGGAGGGGTAGGCTTGT
COX-2 106 F GTTCCACCCGCAGTACAGAA
R AGGGCTTCAGCATAAAGCGT
IL-6 123 F CCTTCGGTCCAGTTGCCTTC
R AGGTGAGTGGCTGTCTGTGT
IL-8 74 F AGAGAGCTCTGTCTGGACCC
R TTCTCAGCCCTCTTCAAAAACT
β-actin 141 F GGATTCCTATGTGGGCGACG
R GCCACACGCAGCTCATTGTA

7. 단백질 발현량 측정

HaCaT cell을 6 well plate에 2×105 cells/well로 분주하여 배양하였으며, 24시간 후, HMC를 50, 100, 200 μg/ml로 1시간동안 전처리하고 human TNF-α를 20 ng/ml로 처리하여 24시간 동안 배양하였다. 모든 배양이 종료된 후, 원심분리하여 얻은 세포는 protease inhibitor(Sigma-Aldrich, USA) 및 phosphatase inhibitor(Sigma-Aldrich, USA)가 포함된 RIPA buffer를 넣어 단백질을 추출하였다. 추출한 단백질은 BCA protein assay kit(Thermo Fisher Scientific, USA)를 이용하여 정량하였고 sample loading buffer와 혼합하여 95℃에서 5분간 반응시켜 준비하였다. 준비된 단백질은 12% acrylamide gel을 사용하여 단백질을 분리하였고 이를 PVDF membrane에 이동시켰다. 단백질이 옮겨진 membrane은 3% BSA에 담가 상온에서 2시간동안 반응시켜 blocking을 진행하였으며, TBS-T buffer로 세척하고 각 primary antibody(Cell Signaling Technology, USA)와 4℃에서 16시간동안 반응시켰다. 반응시킨 membrane을 세척하고 secondary antibody(Jackson ImmunoResearch, USA)와 상온에서 1시간동안 반응시켰으며, 이를 다시 세척하여 ECL solution(iNtRON Biotechnology, Korea)으로 특정 단백질을 발색시켰다. 발색 후, chemidoc fusion FX(VILBER, France)를 통해 iNOS, COX-2, IL-6, IL-8 단백질 발현량을 분석하였다.

8. 실험동물

본 연구에 사용된 4주령의 수컷 Nc/Nga 마우스는 라온바이오(Korea)에서 구입하였으며, 연구기간동안 모든 실험군은 일반 사료(ENVIGO, UK)와 증류수를 공급하였으며, 동물 사육실의 조건은 conventional system으로 22±2℃, 하루 중 12시간은 200-300 lux로 조명하고 12시간은 모든 빛을 차단하였다. 본 연구는 대전대학교 동물실험윤리 위원회의 승인(승인번호 DJUARB2021-008)을 받아 동물윤리준칙에 의거하여 진행하였다.

9. 아토피 피부염 유도 및 시료 처리

Nc/Nga 마우스의 귀 하단부터 꼬리 상단까지 등 부위 전체를 제모하였으며, acetone과 olive oil을 3:1비율로 혼합한 용매에 DNCB를 1%로 용해시킨 용액을 150 μl씩 제모한 부위에 제모 24시간 후부터 2주간 격일로 도포하였다. 주 3회씩 0.5% DNCB(Sigma-Aldrich, USA) 용액을 150 μl를 계속 도포하면서 음성대조군은 증류수, 양성대조군은 dexamethasone (Sigma-Aldrich, USA) 1 mg/kg, 실험군은 HMC를 200, 400 mg/kg을 매일 오전 10시에 200 μl씩 4주간 경구 투여하였다.

10. 혈액 및 조직 검체 분리

4주간의 경구투여가 종료된 후, ethyl ether를 이용하여 실험동물을 마취하고 심장천자법으로 채혈한 혈액을 EDTA tube와 micro centrifuge tube에 나누어 보관하였다. EDTA tube에 담긴 혈액은 즉시 면역세포 수 분석을 진행하였으며, micro centrifuge tube에 담긴 혈액은 30분간 상온에서 굳히고 원심분리(3000 rpm, 15분)하여 혈청을 획득하였고 분석 용량에 맞게 소분하여 초저온 냉동고(-80℃)에 보관하였다. 아토피 피부염을 유발한 등 조직은 수술용 가위로 절개하여 10% formalin에 담아 고정시키거나 초저온 냉동고(-80℃)에 보관하였다.

11. 면역세포 분석

EDTA tube에 보관되어있는 혈액은 hematology system ADVIA 2120i(Siemens, Germany)를 이용하여 백혈구(white blood cell), 림프구(lymphocyte), 호중구(neutrophil), 호산구(eosinophil)수를 분석하였다.

12. 혈액 내 cytokine생성량 측정

96 well plate에 분리한 혈청을 25 μl씩 넣고 assay buffer와 antibody-immobilized bead를 각 25 μl씩 추가하여 상온에서 2시간동안 반응시킨 후 washing buffer를 이용하여 2회 세척을 진행하고 detection antibody을 25 μl씩 넣어 상온에서 1시간동안 반응시켰다. 1시간 후, streptavidin-phycoerythrin을 25 μl씩 추가하고 상온에서 30분간 반응시켰다. 다시 2회 세척하고 sheath fluid를 200 μl씩 넣어 IL-4, IL-5, IL-6, IL-13 생성량을 측정하였으며, Mouse Cytokine/Chemokine Magnetic Bead Kit(Millipore, USA)와 Luminex™ 200™ Instrument System(Luminex, USA)를 사용하였다.

13. 혈액 내 Immunoglobulin E(IgE) 생성량 측정

96 well plate의 각 well에 분리한 혈청을 50 μl씩 넣고 IgE bead를 25 μl씩 추가하여 상온에서 1시간동안 반응시킨 후 washing buffer를 이용하여 3회 세척을 진행하고 anti-mouse light chain PE를 25 μl씩 넣어 상온에서 15분간 반응시켰다. 다시 3회 세척하고 sheath fluid를 200 μl씩 넣어 IgE 생성량을 측정하였으며, Mouse IgE Single Plex Magnetic Bead Kit(Millipore, USA)와 Luminex™ 200™ Instrument System(Luminex, USA)를 사용하였다.

14. 혈액 내 histamine 생성량 측정

96 well plate의 각 well에 분리한 혈청을 50 μl씩 넣고 biotin-labeled antibody를 50 μl씩 추가하여 37℃에서 45분간 반응시킨 후 washing buffer를 이용하여 3회 세척을 진행한다. 세척 후, HRP-streptavidin conjugate를 100 μl씩 넣고 37℃에서 30분간 반응시켰으며, 다시 세척하고 TMB substrate를 90 μl씩 넣어 37℃에서 10분간 반응시켰다. 반응시킨 후, stop solution을 50 μl씩 넣고 microplate reader(Molecular Devices, USA)의 450 nm 파장에서 흡광도를 측정하여 histamine 생성량을 분석하였으며, Histamine ELISA kit(abcam, UK)를 사용하였다.

15. 조직슬라이드 제작 및 분석

피부 조직은 10% formalin에 48시간동안 담가 조직을 고정하고 PBS로 세척하였으며, 파라핀 블럭을 제조하여 5 μm 두께로 연속 박절하여 최적의 부위를 슬라이드 글라스에 부착시킨다. 부착된 조직의 파라핀을 제거시킨 후, 각각 hematoxylin and eosin(H&E) 염색 및 masson's trichrome 염색을 진행하였으며, 각각의 염색 시약은 abcam(UK)사의 Staining Kit를 사용하였다. 염색된 피부 조직은 optical microscope(Olympus, Japan)를 이용하여 사진 촬영 및 분석하였다.

16. 통계처리

연구 결과는 mean±standard error of mean으로 나타내었으며, SPSS Statistics Version 21.0(IBM, U.S.A.)을 이용하였으며, 먼저 두 그룹 간의 통계적 비교는 independent sample t-test를 사용하여 수행하였고 여러 그룹 간의 통계적 비교는 analysis of variance(ANOVA)를 사용하여 수행하였다. 이 후 Tukey’s HSD test를 통해 유의수준 0.05로 설정하여 유의성을 검정하였으며, p＜0.05, p＜0.01 및 p＜0.001의 3가지 유의수준으로 나누어 표기하였다.

결 과
1. 지표성분 분석

HMC에 포함되어 있는 지표성분을 분석한 결과, hesperidin 94.821 mg/L, lupeol 11.254 mg/L, gallic acid 3.543 mg/L, chlorogenic acid 6.028 mg/L, caffeic acid 0.537mg/L, epigallocatechin-3-gallate 20.045 mg/L이 포함되어 있음을 확인하였다(Table 3)(Fig. 1).

Table 3. 
Compound Contents of HMC
Compound name Retention time(min) Contents(mg/L)
Hesperidin 2.794 94.821
Lupeol 5.916 11.254
Gallic acid 7.792 3.543
Chlorogenic acid 17.479 6.028
Caffeic acid 19.255 0.537
Epigallocatechin-3-gallate 23.648 20.045


Fig. 1. 
HPLC chromatogram of HMC main compounds. The main compound of HMC was applied to HPLC under UV wavelength conditions of 254 nm to confirm the contents.

2. 세포생존율

HaCaT 세포에 HMC을 24시간 처리 후 세포 생존율을 측정한 결과, HMC는 200 μg/ml 이하의 농도에서 100% 이상 세포생존율이 나타났으며, 400 μg/ml 농도에서 89% 이하의 세포생존율이 나타났다(Fig. 2). 따라서 이후 실험은 독성이 나타나지 않는 200 μg/ml 이하의 농도로 진행하였다.


Fig. 2. 
Cell viability of HMC in HaCaT cells. HaCaT cells were treated by 50, 100, 200, and 400 μg/ml of HMC for 24 h. Treated cells were reacted by EZ-Cytox for 30 min and then absorbance were measured at 450 nm using micro plate reader. Cell viability were calculated as percentage relative to the control. The result were presented by the mean±standard error of mean from three independent experiments.

3. 세포 내 유전자 발현량

TNF-α로 염증 반응이 유도된 피부 각질 세포에서 발현이 증가하는 iNOS, COX-2, IL-6, IL-8 유전자 발현량에 HMC가 미치는 영향을 측정한 결과, HMC는 50 μg/ml 이상의 농도에서 대조군에 비해 농도 의존적이고 유의성 있는 감소가 나타났다(Fig. 3).


Fig. 3. 
Effects of HMC on mRNA expression level in HaCaT cells. HaCaT cells were treated by 50, 100, and 200 μg/ml of HMC with 20 ng/ml of TNF-α for 24 h. The mRNA expression level were measured using a real-time PCR(qPCR). The result were presented by the mean±standard error of mean from three independent experiments(Significance of results, +++ : p＜0.001 compared to normal, ** ; p＜0.01, *** ; p＜0.001 compared to control).

4. 세포 내 단백질 발현량

TNF-α로 염증 반응이 유도된 피부 각질 세포에서 발현이 증가하는 iNOS, COX-2, IL-6, IL-8 단백질 발현량에 HMC가 미치는 영향을 측정한 결과, HMC는 50 μg/ml 이상의 농도에서 대조군에 비해 농도 의존적이고 유의성 있는 감소가 나타났다(Fig. 4).


Fig. 4. 
Effects of HMC on protein expression level in HaCaT cells. HaCaT cells were treated by 50, 100, and 200 μg/ml of HMC with 20 ng/ml of TNF-α for 24 h. The protein expression level were measured using a western blot assay. The result were presented by the mean±standard error of mean from three independent experiments(Significance of results, +++ : p＜0.001 compared to normal, *** ; p＜0.001 compared to control). (A); protein expression level (B); graph image

5. 혈액 내 cytokine 생성량

DNCB로 아토피 피부염이 유도된 동물 모델의 혈액에서 증가하는 염증성 cytokine인 IL-4, IL-5, IL-6, IL-13 생성량에 HMC가 미치는 영향을 측정한 결과, HMC를 투여한 모든 실험군에서 음성대조군에 비해 농도 의존적이고 유의성 있는 감소가 나타났다(Fig. 5).


Fig. 5. 
Effects of HMC on cytokine level in DNCB-induced atopic mice. The result were presented by the mean±standard error of mean(Significance of results, +++ : p＜0.001 compared to normal, *** ; p＜0.001 compared to control)(n=6).

6. 혈액 내 IgE 및 histamine 생성량

바이러스 감염 및 세균 감염 등으로 알레르기 항원이 비만세포 표면에 있는 면역글로불린 E와 교차결합 시 비만세포의 탈과립으로 증가되는 histamine 과 IgE 생성량을 측정한 결과, HMC를 투여한 모든 실험군에서 음성대조군에 비해 농도 의존적이고 유의성 있는 감소가 나타났다(Fig. 6).


Fig. 6. 
Effects of HMC on IgE and histamine level in DNCB-induced atopic mice. The result were presented by the mean±standard error of mean(Significance of results, +++ : p＜0.001 compared to normal, *** ; p＜0.001 compared to control)(n=6). (A); IgE, (B); histamine

7. 면역세포 수

DNCB로 아토피 피부염이 유도된 동물 모델의 면역세포 수에 HMC가 미치는 영향을 측정한 결과, HMC를 투여한 모든 실험군에서는 백혈구(white blood cell, WBC), 림프구(lymphocyte, LYM), 호중구(neutrophil, NEU), 호산구(eosinophil, EOS) 수가 음성대조군에 비해 농도 의존적이고 유의성 있는 감소가 나타났다(Fig. 7).


Fig. 7. 
Effects of HMC on immunocyte count in DNCB-induced atopic mice. The result were presented by the mean±standard error of mean(Significance of results, +++ : p＜0.001 compared to normal, *** ; p＜0.001 compared to control)(n=6).

8. 조직학적 검사

DNCB로 아토피 피부염이 유도된 동물 모델의 등 조직을 염색하여 조직학적 검사를 진행한 결과, HMC를 투여한 모든 실험군은 음성대조군에 비해 표피와 진피의 두께가 감소하였으며(Fig. 8A, yellow arrow), 피부 기저층에 침윤된 호산구의 수도 음성대조군에 비해 감소하였다(Fig. 8B, red arrow).


Fig. 8. 
Effects of HMC on histological changes in DNCB-induced atopic mice. (A); hematoxylin and eosin(H&E) stain, (B); masson's trichrome stain.

고 찰

아토피(atopy) 질환은 흡입 및 식품 알레르기 항원이 T-helper type 2(Th2) 세포를 자극하여 이로 인해 염증 반응이 유도되는 광범위한 질환으로 알레르기성 비염, 천식 및 아토피 피부염 등이 대표적이다23).

피부질환에 가장 널리 쓰이는 치료제인 국소 스테로이드제는 장시간 사용 시, 섬유아세포의 기능을 억제하거나 콜라겐 생성을 저해시켜 상처의 회복을 지연 시킬 수 있다9). 특히 만성피부질환에서 국소 스테로이드 치료제를 장기간 사용 시 발생하는 부작용을 줄이기 위해 스테로이드 사용을 중단하거나 보습제를 병용해야한다24). 본 연구에서는 염증성 피부질환과 아토피 피부염 개선에 한방 복합물(herbal medicine complex, HMC)의 가능성을 평가하기 위해 HMC의 유효 물질들을 분석하고 인간 유래 각질형성세포주인 HaCaT 세포에 염증 반응을 유도한 세포 모델과 2,4-dinitrochlorobenzene(DNCB)로 아토피 피부염 병태가 유도된 동물 모델에 HMC를 처리 및 투여하여 다양한 병리 인자들을 분석하였다.

먼저 HPLC를 이용하여 HMC에 포함되어있는 유효 물질들을 분석한 결과, 항알레르기와 항염증에 대한 약리작용이 확인된 Hesperidin25), lupeol26), gallic acid27), chlorogenic acid28), caffeic acid29), epigallocatechin-3-gallate30)등이 포함되어 있음을 확인하였고(Fig. 1) 이러한 약리작용을 나타내는 유효 물질들을 바탕으로 HMC가 염증성 피부질환과 아토피 피부염 개선에 효과가 있을 것이라 사료된다. 또한 HaCaT 세포에 HMC를 50, 100, 200, 400 μg/ml 농도로 처리한 결과, 400 μg/ml 농도에서 세포 생존율의 감소가 나타났으며, 200 μg/ml 이하의 농도에서는 세포의 생존에 영향을 미치지 않음을 확인하였고(Fig. 2) 이후 실험에서 200 μg/ml 이하의 농도로 진행하였다

IL-6는 T세포의 활성을 증가시키고 IgE 생산을 증가시켜 만성 알레르기성 염증을 유도하며31), IL-8은 화학주성을 통해 염증 부위로 호중구를 끌어들이고 histamine 발현을 증가시키기 때문에 알레르기성 염증 반응에서 중요한 병리적 인자로 인식되고 있다32). 세포 내부로 들어온 항원의 제거와 염증 반응의 조절을 위해 적정량의 산화질소(nitric oxide, NO)는 필수적이지만 유도성 산화질소 합성 효소(inducible nitric oxide synthase, iNOS)는 염증 반응에서 산화질소의 과도한 생성을 유도하여 염증 반응을 가속화 한다33,34). 또한 cyclooxygenase(COX)는 COX-1과 COX-2 두가지 형태로 분류되며, COX-1은 자극에 의해 변동하지 않고 일정한 수준으로 발현되지만 COX-2는 다양한 자극에 의해 활성화되어, 염증의 초기 단계에서 면역 세포의 활성화를 촉진하여 염증을 악화시키는 prostaglandin E2(PGE2)의 과도한 생성을 유도한다35,36). 따라서 이러한 염증성 인자들을 감소시켜 염증 반응을 개선하는 것이 중요하기에 본 연구에서 TNF-α을 통해 염증 반응이 유도된 HaCaT 세포에 HMC을 50, 100 200 μg/ml을 처리하여 IL-6, IL-8, iNOS, COX-2 의 유전자 및 단백질 발현량을 측정한 결과, HMC는 대조군에 비해 농도 의존적이고 유의적인 감소가 나타났다(Fig. 3,4). 이는 HMC가 피부 염증 반응을 개선시켰으며, 이를 바탕으로 다양한 염증성 피부질환에 대한 치료제로서의 사용가능성을 제시하고 있다.

아토피 피부염은 T helper cell type 2(Th2) 세포의 증식과 함께 이들 세포가 IL-4, IL-5, IL-13 과 같은 사이토카인을 분비하면서 알레르기 증상을 나타나게 하는 것으로 알려져 있다37). Th2 세포가 활성화 되면 IL-4와 IL-5의 시너지 반응으로 B세포가 IgE 클래스로 변경을 유도하고, IL-6는 IgE 생성을 증폭시킨다38). 뿐만 아니라 IL-4와 IL-13은 B세포의 활성화와 IgE 생성을 촉진하기 때문에 알레르기성 염증 반응의 초기에 중요한 인자로 인식되고 있다39). IgE의 증가는 호산구를 포함하는 과립구 및 비만세포를 피부로 침윤시키며, 침윤된 비만세포의 표면에 존재하는 IgE 수용체에 IgE의 결합을 통해 염증성 화학전달물질인 histamine과 leukotriene 생성을 촉진하고 염증성 사이토카인의 활성을 증가시켜 과민반응을 야기한다40). DNCB로 아토피 피부염이 유도된 동물 모델의 혈액을 통해 염증성 사이토카인 생성량을 분석한 결과, HMC를 투여한 모든 실험군에서 음성대조군에 비해 IL-4, IL-5, IL-6, IL-13 생성량이 농도 의존적이고 유의성 있게 감소하였으며(Fig. 5), IgE 와 histamine 생성량도 농도 의존적이고 대조군에 비해 유의성 있는 감소가 나타났다(Fig. 6). 또한 백혈구, 림프구, 호중구, 호산구와 같은 면역세포 수를 확인한 결과, HMC를 투여한 모든 실험군에서 음성대조군에 비해 백혈구, 림프구, 호중구, 호산구 수를 농도 의존적이고 유의성 있게 감소시켰으며(Fig. 7), 이는 HMC가 아토피 피부염에 대한 효과적인 천연물 치료제로서 사용될 수 있음을 증명하고 있다.

마지막으로 동물 모델의 등 부위를 염색하여 조직학적 분석을 진행한 결과, HMC를 투여한 모든 실험군에서 음성대조군에 비해 표피의 두께가 감소하였고(Fig. 8A) 피부 기저층에 침윤된 호산구 수도 감소하였으며(Fig. 8B), 이는 HMC가 표피 및 진피층의 정상화를 유도하여 아토피 피부염으로 인한 2차적 손상에 대한 효과도 확인되었다.

모든 결과를 종합해보면 녹차, 지실, 사매, 어성초 4가지 천연물로 구성된 복합물은 염증 반응이 유도된 피부 세포 모델에서 염증성 사이토카인의 유전자 및 단백질 발현량을 유의적으로 감소시켰으며, 아토피 피부염 병태가 유도된 동물 모델에서 아토피 피부염에서 중요한 IgE 및 histamine과 더불어 염증성 사이토카인과 면역세포 수도 유의적으로 감소시켰다. 또한 유의적인 조직학적 변화도 나타내어 상기 복합물이 아토피 피부염을 비롯한 염증성 피부 질환과 이로 인한 2차적 손상에 대해 효과가 있을 것이라 사료된다.

Acknowledgments

본 연구는 산림청(한국임업진흥원) 산림과학기술 연구개발사업 '(2021370A00-2123-BD02)'의 지원에 의하여 이루어진 것입니다.

References
1. HanifIn JM. Diagnostic features of atopic dermatitis. Acta Derm Venereol. 1980;92:44-7.
2. Grize L, Gassner M, Wüthrich B, Bringolf‐Isler B, Takken‐Sahli K, Sennhauser F, et al. Trends in prevalence of asthma, allergic rhinitis and atopic dermatitis in 5–7‐year old Swiss children from 1992 to 2001. Allergy. 2006;61(5):556-62.
3. Correale CE, Walker C, Murphy L, Craig TJ. Atopic dermatitis: a review of diagnosis and treatment. American family physician. 1999;60(4):1191.
4. Ikoma A. Analysis of the mechanism for the development of allergic skin inflammation and the application for its treatment: mechanisms and management of itch in atopic dermatitis. Journal of pharmacological sciences. 2009;110(3):265-9.
5. Elias P. The skin as an organ of protection. Dermatology in general medicine. 2003:107-18.
6. Irvine AD, McLean WI, Leung DY. Filaggrin mutations associated with skin and allergic diseases. New England Journal of Medicine. 2011;365(14):1315-27.
7. Leung DY. Atopic dermatitis: new insights and opportunities for therapeutic intervention. Journal of Allergy and Clinical Immunology. 2000;105(5):860-76.
8. Whitcup SM, Robinson MR. Development of a dexamethasone intravitreal implant for the treatment of noninfectious posterior segment uveitis. Annals of the New York Academy of Sciences. 2015;1358(1):1-12.
9. Jackson S, Gilchrist H, Nesbitt Jr LT. Update on the dermatologic use of systemic glucocorticosteroids. Dermatologic therapy. 2007;20(4):187-205.
10. Lee Y-B. Translational Study on a Chapter of Taeeum-Disease [太陰病篇] in. Journal of Korean Medical classics. 2010;23(2):33-62.
11. Zhou X, Seto SW, Chang D, Kiat H, Razmovski-Naumovski V, Chan K, et al. Synergistic effects of Chinese herbal medicine: a comprehensive review of methodology and current research. Frontiers in Pharmacology. 2016;7:201.
12. Caesar LK, Cech NB. Synergy and antagonism in natural product extracts: when 1+ 1 does not equal 2. Natural product reports. 2019;36(6):869-88.
13. Williamson EM. Synergy and other interactions in phytomedicines. Phytomedicine. 2001;8(5):401-9.
14. Kim TH, Ha SY, Yang J-K. Inhibitory Effects of Camellia sinensis Extract on the Development of Atopic Dermatitis-like Lesions in NC/Nga Mice. Journal of the Korean Wood Science and Technology. 2014;42(5):579-89.
15. Gramza A, Korczak J. Tea constituents (Camellia sinensis L.) as antioxidants in lipid systems. Trends in Food Science & Technology. 2005;16(8):351-8.
16. Lee JS, Kim IS, Ryu JS, Kim JH, Kim JS, Kim DH, et al. The Inhibitory Effect of Duchesnea chrysantha Extract on the Development of Atopic Dermatitis‐like Lesions by Regulating IgE and Cytokine Production in Nc/Nga Mice. Phytotherapy Research. 2012;26(2):284-90.
17. Lee D-J, Jeon I-H, Kim H-S, Cho I-Y, Jang S-I. Antioxidative and anti-inflammatory effect of ethanol extract from Duchesnea chrysantha. Journal of Physiology & Pathology in Korean Medicine. 2012;26(1):59-66.
18. Cha K-J, Kashif A, Hong MH, Kim G, Lee J-S, Kim IS. Poncirus Trifoliata (L.) Raf. Extract Inhibits the Development of Atopic Dermatitis-like Lesions in Human Keratinocytes and NC/Nga mice. International Journal of Medical Sciences. 2019;16(8):1116.
19. Zhou HY, Shin EM, Guo LY, Zou LB, Xu GH, Lee S-H, et al. Anti-inflammatory activity of 21 (α, β)-methylmelianodiols, novel compounds from Poncirus trifoliata Rafinesque. European journal of pharmacology. 2007;572(2-3):239-48.
20. Lee HJ, Seo HS, Kim GJ, Jeon CY, Park JH, Jang BH, et al. Houttuynia cordata Thunb inhibits the production of pro‑inflammatory cytokines through inhibition of the NFκB signaling pathway in HMC‑1 human mast cells. Molecular medicine reports. 2013;8(3):731-6.
21. Li J, Zhao F. Anti-inflammatory functions of Houttuynia cordata Thunb. and its compounds: A perspective on its potential role in rheumatoid arthritis. Experimental and Therapeutic Medicine. 2015;10(1):3-6.
22. Hong SC, Eo H-J, Song H-M, Woo S-H, Kim M-K, Lee J-W, et al. Houttuynia cordata Thunberg exhibits anti-tumorigenic activity in human gastric cancer cells. The Korea Journal of Herbology. 2013;28(6):155-60.
23. Bellanti JA, Settipane RA. The atopic disorders and atopy … "strange diseases" now better defined! Allergy and asthma proceedings. 2017;38(4):241-2.
24. Lee JH, Park YM. Proper use of topical corticosteroids. Journal of the Korean Medical Association. 2018;61(10):632-6.
25. Parhiz H, Roohbakhsh A, Soltani F, Rezaee R, Iranshahi M. Antioxidant and anti‐inflammatory properties of the citrus flavonoids hesperidin and hesperetin: an updated review of their molecular mechanisms and experimental models. Phytotherapy Research. 2015;29(3):323-31.
26. Lucetti DL, Lucetti EC, Bandeira MAM, Veras HN, Silva AH, Leal LKA, et al. Anti-inflammatory effects and possible mechanism of action of lupeol acetate isolated from Himatanthus drasticus (Mart.) Plumel. Journal of Inflammation. 2010;7(1):1-11.
27. Liu KY, Hu S, Chan BC, Wat EC, Lau CB, Hon KL, et al. Anti-inflammatory and anti-allergic activities of Pentaherb formula, Moutan Cortex (Danpi) and gallic acid. Molecules. 2013;18(3):2483-500.
28. Dong F, Tan J, Zheng Y. Chlorogenic acid alleviates allergic inflammatory responses through regulating Th1/Th2 balance in ovalbumin-induced allergic rhinitis mice. Medical Science Monitor: International Medical Journal of Experimental and Clinical Research. 2020;26:e923358-1.
29. Hossen MA, Inoue T, Shinmei Y, Minami K, Fujii Y, Kamei C. Caffeic acid inhibits compound 48/80-induced allergic symptoms in mice. Biological and Pharmaceutical Bulletin. 2006;29(1):64-6.
30. Choi YS, Bae CH, Song S-Y, Kim Y-D. The effect of Epigallocatechin-3-gallate in allergic airway inflammation. Rhinology. 2014;52(4):406-12.
31. Boudreau RT, Hoskin DW, Lin TJ. Phosphatase inhibition potentiates IL‐6 production by mast cells in response to FcɛRI‐mediated activation: involvement of p38 MAPK. Journal of leukocyte biology. 2004;76(5):1075-81.
32. Salamon P, Shoham N, Gavrieli R, Wolach B, Mekori Y. Human mast cells release Interleukin‐8 and induce neutrophil chemotaxis on contact with activated T cells. Allergy. 2005;60(10):1316-9.
33. Surh Y-J, Chun K-S, Cha H-H, Han SS, Keum Y-S, Park K-K, et al. Molecular mechanisms underlying chemopreventive activities of anti-inflammatory phytochemicals: down-regulation of COX-2 and iNOS through suppression of NF-κB activation. Mutation Research/Fundamental and Molecular Mechanisms of Mutagenesis. 2001;480:243-68.
34. Soufli I, Toumi R, Rafa H, Touil-Boukoffa C. Overview of cytokines and nitric oxide involvement in immuno-pathogenesis of inflammatory bowel diseases. World journal of gastrointestinal pharmacology and therapeutics. 2016;7(3):353.
35. Gandhi J, Khera L, Gaur N, Paul C, Kaul R. Role of modulator of inflammation cyclooxygenase-2 in gammaherpesvirus mediated tumorigenesis. Frontiers in microbiology. 2017;8:538.
36. Cho W, Choe J. Prostaglandin E2 stimulates COX-2 expression via mitogen-activated protein kinase p38 but not ERK in human follicular dendritic cell-like cells. BMC immunology. 2020;21(1):1-8.
37. Bryan SA, O'Connor BJ, Matti S, Leckie MJ, Kanabar V, Khan J, et al. Effects of recombinant human interleukin-12 on eosinophils, airway hyper-responsiveness, and the late asthmatic response. The Lancet. 2000;356(9248):2149-53.
38. Brandt EB, Sivaprasad U. Th2 cytokines and atopic dermatitis. Journal of clinical & cellular immunology. 2011;2(3).
39. Homey B, Steinhoff M, Ruzicka T, Leung DY. Cytokines and chemokines orchestrate atopic skin inflammation. Journal of Allergy and Clinical Immunology. 2006;118(1):178-89.
40. Jun J-H, Kang Y-H. The Effects of Scutellaria baicalensis GEORGI on Allergic contact dermatitis induced by DNCB in Mice. The Journal of Dong Guk Oriental Medicine. 1998;7(1):119-33.
 
Department of Pathology, College of Korean Medicine, Wongkwang University, 460, Iksan-daero, Iksan-si, Jeollabuk-do, 570-749, Korea
TEL: +82-63-850-6835, FAX: +82-63-856-6843
E-mail: herb1@wku.ac.kr