Journal Archive

Journal of Physiology & Pathology in Korean Medicine - Vol. 35 , No. 5
[Paper List] [Go to Volume List]

[ ORIGINAL ARTICLES ]
Journal of Physiology & Pathology in Korean Medicine - Vol. 35, No. 5, pp. 177-184
Abbreviation: J Physiol & Pathol Korean Med
ISSN: 1738-7698 (Print) 2288-2529 (Online)
Print publication date 25 Oct 2021
Received 24 Aug 2021 Revised 22 Oct 2021 Accepted 22 Oct 2021
DOI: https://doi.org/10.15188/kjopp.2021.10.35.5.177

HCT116 인체 대장암 세포주에서 상백피 추출물에 의한 전이 억제 효과
박신형* ; 박현지
동의대학교 한의과대학 병리학교실

Root Bark extract of Morus alba L. Suppressed the Migration and Invasion of HCT116 Human Colorectal Carcinoma Cells
Shin-Hyung Park* ; Hyun-Ji Park
Department of Pathology, College of Korean Medicine, Dong-eui University
Correspondence to : *Shin-Hyung Park, Department of Pathology, College of Korean Medicine, Dong-eui University, 47227, YangJeong-ro, Busanjin-gu, Busan, Republic of Korea ·E-mail : omdpark@deu.ac.kr ·Tel : +82-51-890-3332


Ⓒ The Society of Pathology in Korean Medicine, The Physiological Society of Korean Medicine
Funding Information ▼
Abstract

The root bark of Morus alba L. (MA) used in traditional oriental medicine for the treatment of pulmonary diseases exerts various pharmacological activities including anticancer effects. In the current study, we investigated the effects of MA on the migration and invasion of colorectal carcinoma cells. Results from a transwell assay showed that the methylene chloride extract of MA (MEMA) suppressed the migration and invasion of HCT116 human colorectal carcinoma cells in a concentration-dependent manner. MEMA reduced both mRNA and protein levels of matrix metalloproteinase (MMP)-9, but did not suppress the expression of MMP-2 in HCT116 cells. As a molecular mechanism, MEMA inhibited the phosphorylation of mitogen-activated protein kinases (MAPKs), including ERK, JNK and p38, in a dose-dependent manner. In addition, MEMA dephosphorylated both Src and signal transducer and activator of transcription 3 (STAT3) in HCT116 cells. Taken together, we demonstrate that MEMA suppressed the migration and invasion capacity of HCT116 human colorectal cancer cells by downregulation of MMP-9 and inactivation of both MAPKs and Src/STAT3 signaling pathway.

Keywords: Morus alba L., Colorectal cancer, Migration, Invasion
서 론

대장암은 세계적으로 발생률 3위 암종이며, 암으로 인한 사망률 2위를 차지하고 있다1). 한국에서도 대장암은 남녀 공히 발생률 3위를 차지하고 있으며, 2019년 기준 암으로 인한 전체 사망자 중 11%가 대장암으로 사망하여 사망률 3위를 차지하였다2). 대장암의 주요 위험요인으로서 적색육과 알코올의 과잉 섭취, 흡연, 체중증가 등이 꼽히고 있으며, 대장암 환자의 10~20%가 가족력을 가지고 있다3). 일반적으로 선종성 장내 폴립에 adenomatous polyposis coli (APC), KRAS, BRAF, TP53 등의 유전자 돌연변이가 축적되면서 대장암으로 발전하는 것으로 알려져 있다3,4). 대장암 환자가 전이 없이 국소병변만 가지고 있는 경우 5년 생존율이 90%에 달하지만, 원장기로 전이가 일어난 경우 5년 생존율은 14%에 불과하다5). 따라서 대장암의 전이를 효과적으로 억제할 수 있는 약물의 개발이 절실한 실정이다.

현재까지 대장암의 성장 및 전이를 억제하기 위해 다양한 표적치료제가 개발되어 왔다. 예를 들어 혈관내피성장인자(vascular endothelial growth factor, VEGF) 수용체를 차단하여 신생혈관 형성을 억제하는 bevacizumab과 상피성장인자(epidermal growth factor receptor, EGFR) 수용체를 차단하여 대장암의 증식과 생존을 억제하는 cetuximab 등이 전이성 대장암 치료에 활용되고 있다5-8). 그 밖에 대장암에서 BRAF와 HER2를 표적으로 하는 약물들의 효과를 검증하기 위해 여러 임상연구가 진행되고 있다5,9,10). 그러나 치료효과는 여전히 제한적이며, 최근 각광받고 있는 다른 약물과의 병용투여 전략은 독성에 대한 문제가 지속적으로 제기되고 있다5).

상백피는 뽕나무과에 속한 Morus alba L.의 根皮로서 性은 寒하고 味는 甘하다11). 瀉肺平喘, 利水消腫하는 효능을 가져 肺熱로 인한 기침과 천식 및 小便不利로 인한 水腫을 치료한다11). 상백피의 주요 성분으로서 terpenoid인 betulinic acid와 ursolic acid, flavonoid인 morusin, mulberrin, kuwanons 및 sanggenons, stilbenoid인 moracin, mulberroside 등이 알려져 있다12). 최근 연구에 따르면 상백피는 상기도의 염증과 뮤신 분비를 억제할 뿐만 아니라 조절 T세포 증식 및 Th2 사이토카인 억제를 통해 천식을 치료할 수 있고13-15), 그 밖에 항산화, 항바이러스 및 지질강하 효과 등을 가진다16,17). 본 연구진은 상백피의 전통적 용도가 폐 질환에 있음에 착안하여 상백피 추출물이 폐암세포의 증식과 전이능을 억제함을 보고한 바 있다18,19). 그러나 기존 논문들을 살펴보면 상백피의 항암효과는 비단 폐암에만 한정되어 있지 않으며, 대장암, 백혈병, 신경모세포종 등 다양한 암종으로 확대된다20-22). 상백피 추출물은 암세포에 세포주기정지(cell cycle arrest) 및 아폽토시스(apoptosis)를 유발하여 암의 증식을 억제할 뿐만 아니라18,20-22), 상피간엽이행(epithelial-mesenchymal transition, EMT) 및 종양연관대식세포(tumor-associated macrophage, TAM)를 저해하여 암세포의 전이를 억제하였다19,23). 이러한 상백피 추출물의 암세포 및 종양미세환경에 대한 광범위한 조절작용은 상백피의 새로운 암치료제로서의 가능성을 시사한다.

이에 본 연구는 상백피 추출물이 대장암 세포주의 전이를 효과적으로 제어할 수 있는지 여부를 암세포의 이동능과 전이능을 중심으로 조사하였고, 그 분자적 기전을 탐구하여 유의한 결과를 얻었기에 보고하는 바이다.

재료 및 방법
1. 시료 제조

본 실험에 사용된 상백피는 ㈜누리허브(Youngcheon, Korea)에서 구입하였다. 먼저 잘게 파쇄한 상백피 100 g에 메틸렌클로라이드 1.5 ℓ를 첨가한 후 20분씩 3회 sonication 시켰다. 그 후 상온에서 120 rpm으로 교반시키면서 24시간 동안 추출하였다. 추출액을 모은 후 3000 rpm에 20분간 원심분리시키고, 상층액을 필터를 통해 여과하였다. 추출액은 감압농축 후 72시간 동안 동결건조하였으며, 이렇게 얻어진 최종 분말(수율 4%)을 상백피 메틸렌 클로라이드 추출물(methylene chloride extract of Morus alba L., MEMA)로 명명하였다. MEMA는 dimethylsulfoxide (DMSO; Amresco, Solon, OH, USA)에 50 ㎎/㎖ 농도로 녹여 –80℃에 보관하였으며, 매 실험 직전에 배지에 희석하여 사용하였다. 본 연구진의 선행연구에서 고성능 액체 크로마토그래피(High Performance Liquid Chromatography, HPLC) 분석 결과 MEMA가 상백피의 지표성분인 morusin을 포함하고 있음을 확인하였다19).

2. 세포 배양

HCT116 인체 대장암 세포주는 Bert Vogelstein 박사(Johns Hopkins University, Baltimore, MD, USA)로부터 제공받았다. RPMI-1640 (WelGENE, Seoul, Korea) 90%, fatal bovine serum (FBS; WelGENE) 10%, antibiotics (WelGENE) 1%를 혼합하여 배지로 사용하였으며, 세포는 37℃, 5% CO2 조건에서 배양하였다.

3. MTT assay

HCT116 세포를 3×103 cells/well 농도로 96 well plate에 분주하고, 다음 날 MEMA를 다양한 농도조건(5~100 ㎍/㎖)으로 처리하였다. 24시간 배양 후 MTT [3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide; Duchefa, Haarlem, The Netherlands] solution을 0.5 ㎍/㎖ 농도가 되도록 배지에 처리하여 2시간 동안 37℃에서 반응시켰다. 그 후 배지를 모두 제거하고 DMSO 100 ㎕를 각 well에 분주한 후 30분간 교반시키면서 formazan을 완전히 용해시켰다. 흡광도는 multiplate reader (SpectraMax M3; Molecular Devices, San Jose, CA, USA)를 사용하여 540 nm에서 측정하였다.

4. Transwell assay

24 well transwell (8.0 ㎛ pore size, Corning, NY, USA)의 upper chamber의 outer membrane을 0.1% gelatin (Sciencell, Carlsbad, CA, USA)으로 코팅한 후 상온에서 1시간 동안 굳혔다. 그 다음 HCT116 세포를 3×105 cells/well 농도로 upper chamber에 분주하면서 MEMA를 농도별(10~50 ㎍/㎖)로 처리하였다. Lower chamber에는 HCT116 세포의 유인물질로서 20% FBS를 포함한 RPMI-1640 배지를 분주하였다. 24시간 배양 후 upper chamber를 분리하여 메탄올로 5분간 고정하였고, hematoxylin (Sigma‐Aldrich, St Louis, MO, USA)으로 30분간 염색하였다. 증류수로 수차례 세척한 후 염색된 세포를 현미경(Carl Zeiss, Oberkochen, Germany)으로 촬영하였으며, 염색된 세포 숫자를 계수함으로써 HCT116 세포의 이동능을 파악하였다. HCT116 세포의 침윤능을 평가하기 위해서는 upper chamber의 outer membrane을 0.1% gelatin으로 코팅한 후 inner membrane을 300 ㎍/㎖ matrigel (BD Bioscience, San Jose, CA, USA)로 코팅하여 상온에서 2시간 굳힌 후 사용하였으며, 나머지 과정은 상기한 바와 동일하다.

5. Reverse Transcription Polymerase Chain Reaction (RT-PCR)

HCT116 세포를 5×105 cells/well 농도로 60 ㎜ dish에 분주하고, overnight 안정화 후 MEMA를 농도별로(5~50 ㎍/㎖) 처리하였다. 24시간 배양 후 세포들을 모아 TRIZOL reagent (Invitrogen; Thermo Fisher Scientific, Waltham, MA)로 total RNA를 추출하였다. 그 다음 multiplate reader (SpectraMax M3; Molecular Devices)를 사용하여 RNA 정량 후 1 ㎍ RNA를 PrimeScript RT reagent kit (Takara, Dalian, China)을 사용하여 first strand cDNA로 합성하였다. 그 후 2X reaction buffer (Promega, Madison, WA, USA)를 넣고 SimpliAmp Thermal Cycler (Applied Biosystems, Forster City, CA)를 사용하여 cDNA를 증폭시켰다. PCR 조건은 Table 1과 같다. 증폭된 PCR 산물은 nucleic acid gel staining solution (RBC, Taipei, Taiwan)을 포함한 1.5% agarose gel (Lonza, Rockland, ME)에 분주하여 10분간 전기영동 하였으며, Gel Imaging System (Daihan Scientific, Seoul, Korea)을 사용하여 mRNA 발현을 확인하였다.

Table 1. 
PCR condition
Gene Primer sequence Annealing
temperature (℃)		 Cycle
numbers
MMP-9 Forward: GAGGCGACGTGAAGGCGCAG
Reverse: CATAGGTCACGTAGCCCACT		 55 35
MMP-2 Forward: AGATCTTCTTCTTCAAGGACCGGTT
Reverse: GGCTGGTCAGTGGCTTGGGGTA		 62 35
ACTB (Actin) Forward: ACTACCTCATGAAGATC
Reverse: GATCCACATCTGCTGGAA		 55 20

6. Western blot

HCT116 세포를 5×105 cells/well 농도로 60 ㎜ dish에 분주하고, 다음 날 MEMA를 다양한 농도조건(5~50 ㎍/㎖)으로 처리하였다. 24시간 배양 후 세포들을 모아 차가운 lysis buffer [RIPA buffer (Thermo Fisher Scientific, San Jose, CA, USA), protease inhibitor cocktail (Thermo Fisher Scientific), phosphatase inhibitors (1 mM Na3VO4, 100 mM NaF)]를 넣고 간헐적으로 볼텍싱하면서 30분간 용해시켰다. 13000 rpm에서 30분간 원심분리시켜 얻은 상층액을 bicinchoninic acid (BCA) protein assay kit (Pierce Biotechnology, Rockford, IL, USA)를 사용하여 정량하였다. 그 후 20 ㎍의 단백질을 sodium dodecyl sulfate poly acrylamide gel electrophoresis (SDS-PAGE)를 통해 분리시키고, PVDF 멤브레인(Millipore Corporation, Bedford, MA)에 transfer하였다. 멤브레인은 3% bovine serum albumin (BSA, GenDEPOT, TX, USA)으로 30분간 blocking 후 1차 항체(1:500~1:1000 희석)와 4℃에서 overnight으로 반응시켰다. 다음 날 멤브레인을 TBST [Tris‑buffered saline (TBS) supplemented with 0.1% Tween‑20]로 1시간 가량 세척하고, 상온에서 50분간 2차 항체(1:10000 희석)와 반응시켰다. 다시 TBST로 멤브레인을 세척한 후 D-Plus ECL Femto System (Donginbio, Seoul, Korea)을 사용하여 형광을 확인하였다. Phospho-ERK (Thr202/Tyr204), phospho-p38 (Thr180/Tyr182), phospho-JNK (Thr183/Tyr185), phospho-STAT3 (Tyr 705) 및 phospho-Src (Tyr 416) 항체는 Cell Signaling Technology (Beverly, MA, USA)에서 구입하였으며, MMP-2, MMP-9, ERK, p38, JNK, STAT3, Src 및 actin 항체는 Santa Cruz Biotechnology Inc. (Santa Cruz, CA, USA)에서 구입하였다. Anti‑mouse 2차 항체와 anti‑rabbit 2차 항체는 각각 Bethyl Laboratories (Montgomery, TX, USA)와 Enzo Life Sciences (Farmingdale, NY, USA)에서 구입하였다.

7. 통계적 분석

모든 실험 결과는 평균±표준편차로 표시하였으며, 통계적 유의성 검증은 Student’s t-test를 이용하여 P < 0.05인 것을 유의성 있는 것으로 판단하였다.

결 과
1. MEMA의 농도조건 설정

먼저 MEMA가 HCT116 인체 대장암 세포주의 증식에 영향을 미치지 않는 농도조건을 설정하기 위해 HCT116 세포에 다양한 농도(5~100 ㎍/㎖)로 MEMA를 처리하고 24시간 후 MTT assay를 시행하였다. 만약 MEMA가 HCT116 세포의 증식을 억제한다면, transwell 결과 MEMA가 암세포의 이동을 감소시킨다 해도 이러한 결과가 세포증식 억제에서 비롯된 것인지 순수한 이동능 억제에서 비롯된 것인지 파악하기 어렵기 때문이다. MTT assay 결과 MEMA 50 ㎍/㎖ 처리군까지는 세포생존율이 90% 이상으로 나타나 HCT116 세포의 증식에 큰 영향을 미치지 않는 것으로 나타났다(Fig. 1). 이에 MEMA 50 ㎍/㎖를 최고농도로 설정하여 추후실험을 진행하였다.


Fig. 1. 
Effects of MEMA on the cell viability of HCT116 cells. HCT116 human colorectal carcinoma cells were incubated with various concentrations of MEMA (5-100 ㎍/㎖). Cell viability was measured by MTT assay at 24 h post-treatment of MEMA. Values are expressed as the mean ± SD of three independent experiments. The dotted line indicates the cell viability of 90%. MEMA, methylene chloride extract of Morus alba L.

2. MEMA가 HCT116 인체 대장암 세포주의 이동능(migration capacity)에 미치는 영향

다음으로 MEMA가 HCT116 세포의 이동능에 미치는 영향을 확인하기 위해 HCT116 세포에 농도별(10~50 ㎍/㎖)로 MEMA를 처리하고 24시간 후 transwell assay를 시행하였다. Outer membrane으로 이동하여 염색된 세포의 숫자를 계수하여 HCT116 세포의 이동능을 파악한 결과 대조군에 비해 MEMA 10 ㎍/㎖ 처리 시 43.24±4.71%, 25 ㎍/㎖ 처리 시 19.29±2.55%, 50 ㎍/㎖ 처리 시 6.52±0.78%의 세포만이 각각 이동하여 농도의존적 감소를 보였다(Fig. 2A and 2B). 이러한 결과는 MEMA가 농도의존적으로 HCT116 세포의 이동능을 억제함을 보여준다.


Fig. 2. 
Effects of MEMA on the migration of HCT116 cells. HCT116 human colorectal carcinoma cells were plated into the gelatin-coated upper chamber of a 24-well format transwell plate and treated with various concentrations of MEMA (10-50 ㎍/㎖). 20% FBS medium was loaded into the bottom chamber as a chemoattractant. After 24 h of incubation, the migrated cells were stained and photographed under a microscope (100× magnification). (A) The representative fields of three independent experiments are shown. (B) The relative migration was evaluated by counting the number of stained cells. Values are expressed as the mean ± SD of three independent experiments. Significance was determined by the Student’s t-test (*** p < 0.001 versus untreated controls). MEMA, methylene chloride extract of Morus alba L.

3. MEMA가 HCT116 인체 대장암 세포주의 침윤능(invasion capacity)에 미치는 영향

암세포는 타 장기로 전이하기 위해 종양을 둘러싸고 있는 조직을 침윤하여 혈관 속으로 이동하게 된다24). 따라서 암세포의 침윤능을 조절할 수 있다면 암의 전이를 효과적으로 억제할 수 있을 것이다. MEMA가 HCT116 세포의 이동능 뿐만 아니라 침윤능에도 영향을 미치는지 확인하기 위해 MEMA를 농도별(10~50 ㎍/㎖)로 처리한 후 transwell assay를 시행하였다. 그 결과 대조군에 비해 MEMA 10, 25, 50 ㎍/㎖ 처리 시 각각 94.25±4.07%, 58.21±4.29%, 37.21±1.57%의 세포만이 matrigel을 침윤하여 이동한 것으로 나타났다(Fig. 3A and 3B). 10 ㎍/㎖ 처리군에서는 유의성이 나타나지 않았으나, 25 ㎍/㎖ 처리군부터는 현저한 감소추세를 보였다. 이러한 결과는 MEMA가 농도의존적으로 HCT116 세포의 침윤능을 저해함을 보여준다.


Fig. 3. 
Effects of MEMA on the invasion of HCT116 cells. HCT116 human colorectal carcinoma cells were plated into the upper chamber coated with gelatin (outer membrane) and matrigel (inner membrane), and were treated with various concentrations of MEMA (10-50 ㎍/㎖). 20% FBS medium was loaded into the bottom chamber as a chemoattractant. After 24 h of incubation, the invaded cells were stained and photographed under a microscope (100× magnification). (A) The representative fields of three independent experiments are shown. (B) The relative invasion was evaluated by counting the number of stained cells. Values are expressed as the mean ± SD of three independent experiments. Significance was determined by the Student’s t-test (n.s. not significant, *** p < 0.001 versus untreated controls). MEMA, methylene chloride extract of Morus alba L.

4. MEMA가 HCT116 인체 대장암 세포주의 matrix metalloproteinases (MMPs) 발현에 미치는 영향

MMPs는 세포외기질의 분해에 관여하는 protease로서 특히 gelatinase에 속하는 MMP-9과 MMP-2는 암의 전이에 핵심적인 역할을 하는 것으로 알려져 있다25). 이에 MEMA가 HCT116 세포의 MMPs 발현에 미치는 영향을 조사하였다. 먼저 MEMA를 농도별(5~50 ㎍/㎖)로 처리한 후 RT-PCR을 시행한 결과 농도의존적으로 MMP-9의 mRNA 수준이 감소하는 것을 확인하였다. 그러나 MEMA는 MMP-2의 mRNA 수준에는 영향을 미치지 못했다(Fig. 4A). 웨스턴블롯 결과도 동일한 경향을 보여 MEMA 처리에 의해 MMP-9의 단백질 발현이 감소하였으나 MMP-2의 발현은 억제하지 못했다(Fig. 4B). 이러한 결과는 MEMA가 HCT116 세포의 MMP-9 발현을 전사수준에서부터 감소시켜 암세포의 이동 및 침윤을 조절할 것임을 시사한다.


Fig. 4. 
Effects of MEMA on the expression of MMPs in HCT116 cells. HCT116 human colorectal carcinoma cells were incubated with various concentrations of MEMA (5-50 ㎍/㎖) for 24 h. (A) The mRNA level of MMP-9 and MMP-2 was assessed by RT-PCR. Actin was used as an internal control. (B) The protein expression of MMP-9 and MMP-2 was detected by western blot. Actin was used as a loading control. The representative images of three independent experiments are shown. MEMA, methylene chloride extract of Morus alba L.; MMP, matrix metalloproteinase.

5. MEMA가 HCT116 인체 대장암 세포주의 mitogen-activated protein kinase (MAPK) 단백질 인산화에 미치는 영향

MEMA가 HCT116 세포의 이동능과 침윤능을 저해하는 분자적 기전을 밝히기 위해 MEMA를 24시간 동안 농도별(10~50 ㎍/㎖)로 처리한 후 웨스턴블롯을 통해 MAPK 단백질의 인산화를 확인하였다. MAPK 단백질은 암의 성장과 전이를 조절할 수 있는 대표적인 단백질 키나제로서 ERK, p38, c-Jun N-terminal kinases (JNK)의 3종류가 존재한다26). 실험 결과 ERK와 JNK의 인산화는 MEMA 25 ㎍/㎖ 처리군부터 유의하게 감소하였고, p38의 인산화는 MEMA 10 ㎍/㎖ 처리군부터 농도의존적으로 감소하는 것을 확인할 수 있었다(Fig. 5A and 5B). 앞서 MEMA 10 ㎍/㎖ 처리군에서 이미 이동능 감소가 관찰되었으므로 이는 p38의 탈인산화와 관련 있을 것으로 추정되고, 25 ㎍/㎖ 처리군부터는 다수의 MAPK 단백질이 복합적으로 작용하여 암세포의 이동능과 침윤능을 억제했을 것으로 사료된다. 종합하면 MEMA는 MAPK 단백질의 인산화를 저해함으로써 HCT116 세포의 전이능을 감소시켰다.


Fig. 5. 
Effects of MEMA on the phosphorylation of MAPKs in HCT116 cells. HCT116 human colorectal carcinoma cells were incubated with various concentrations of MEMA (10-50 ㎍/㎖) for 24 h. (A) The phosphorylation or total level of ERK, p38 and JNK was assessed by western blot. Actin was used as an internal control. (B) The ratio of phospho/total protein was calculated using Image J software after normalization with actin. Values are expressed as the mean ± SD of three independent experiments. Significance was determined by the Student’s t-test (n.s. not significant, * p < 0.05, ** p < 0.01, *** p < 0.001 versus untreated controls). MEMA, methylene chloride extract of Morus alba L.; MAPK, mitogen-activated protein kinase.

6. MEMA가 HCT116 인체 대장암 세포주의 Src과 signal transducer and activator of transcription 3 (STAT3) 인산화에 미치는 영향

Src은 비수용체 티로신키나제로서 세포이동과 부착을 조절하여 암의 전이에 핵심적인 역할을 한다27). STAT3는 암의 불량한 예후에 기여하는 대표적인 전사인자로서 암세포의 증식과 전이를 촉진하고 세포사멸에 저항하는 다양한 유전자의 전사를 조절한다28). 본 연구진은 선행연구에서 MEMA가 Src과 STAT3의 활성을 억제하여 폐암세포의 이동 및 전이를 저해하는 것을 보고한 바 있다19). 이에 MEMA가 HCT116 대장암세포주의 Src과 STAT3 인산화에도 영향을 미칠 수 있는지 웨스턴블롯을 통해 확인하였다. 그 결과 Src은 MEMA 50 ㎍/㎖ 처리군에서 현저히 탈인산화되었으며, STAT3는 MEMA 25 ㎍/㎖ 처리군부터 농도의존적으로 인산화가 감소하는 것을 확인할 수 있었다 (Fig. 6A and 6B). 상기한 결과는 MEMA가 MAPK 뿐만 아니라 Src과 STAT3의 활성을 억제함으로써 HCT116 세포의 전이능을 감소시켰을 가능성을 시사한다.


Fig. 6. 
Effects of MEMA on the phosphorylation of Src and STAT3 in HCT116 cells. HCT116 human colorectal carcinoma cells were treated with various concentrations of MEMA (10-50 ㎍/㎖) for 24 h. (A) The phosphorylation or total level of Src and STAT3 was assessed by western blot. Actin was used as a loading control. (B) The ratio of phospho/total protein was calculated using Image J software after normalization with actin. Values are expressed as the mean ± SD of three independent experiments. Significance was determined by the Student’s t-test (n.s. not significant, ** p < 0.01, *** p < 0.001 versus untreated controls). MEMA, methylene chloride extract of Morus alba L.; STAT3, signal transducer and activator of transcription 3.

고 찰

대장암은 높은 발병률과 사망률을 지닌 암종으로서 원격 전이가 일어난 대장암의 경우 예후가 극히 불량하므로 대장암의 전이를 효과적으로 제어할 수 있는 약물의 개발이 시급하다. 이에 본 연구에서는 상백피 추출물이 대장암 세포주의 전이능을 조절할 수 있는지 조사하였다. 그 결과 MEMA는 HCT116 인체 대장암 세포주의 이동능과 침윤능 및 MMP-9의 발현을 감소시켰다. 또한 MEMA는 ERK, JNK, p38 MAPK 및 Src/STAT3의 인산화를 현저히 저해하여 MEMA가 이들을 통해 전이억제효과를 나타낼 것임을 시사하였다. 본 연구진은 선행 연구에서 MEMA가 폐암 세포주의 Src/STAT3 경로를 조절함으로써 전이능을 감소시킴을 보고하였다19). 본 연구에서는 MEMA가 대장암 세포주에서도 Src/STAT3를 억제할 뿐만 아니라 MAPK를 조절하여 암세포의 이동과 침윤을 억제함을 밝혔다. 이러한 연구결과는 비록 전통적인 상백피의 적응증이 폐 질환에 있다고 해도 항암작용에 있어서는 보다 폭넓은 장기에 영향을 미칠 수 있음을 제안하는 것이다. 그러나 MEMA가 폐암 세포주에서 10 ㎍/㎖ 이하 농도에서 현저한 전이억제효과를 보인 반면19) 대장암 세포주에서는 상대적으로 높은 농도(10~50 ㎍/㎖)에서 효과를 보여 상백피 추출물에 대한 암종별 민감도는 추후 연구가 더 진행되어야 하는 부분이다.

MMP-9은 암의 침윤과 전이 및 혈관신생을 촉진하며 종양미세환경을 암에게 유리하도록 조절하여 암의 성장과 진행을 매개하는 분자이다. 이에 MMP-9을 암의 바이오마커로 활용하거나 효과적으로 저해할 수 있는 약물을 개발하려는 시도가 계속되고 있다25). 기존 연구에 따르면 ERK, JNK, p38 MAPK는 모두 MMP-9의 발현을 조절하는 인자들이다29-31). 이들은 MMP-9의 전사인자인 NF-κB와 AP-1 등을 인산화시켜 궁극적으로 MMP-9의 발현을 촉진한다29,30). 흥미롭게도 Cho 등은 ERK와 p38 MAPK가 MMP-9의 발현은 조절할 수 있으나, MMP-2의 발현에는 영향을 미치지 못함을 보고한 바 있다31). 본 연구결과에서도 MEMA가 MMP-2를 제외한 MMP-9 발현만을 조절하였는데, 이는 MEMA가 MAPK를 통해 MMP-9의 발현을 저해했을 가능성을 시사한다. MEMA에 의해 탈인산화되었던 STAT3와 Src 역시 MMP-9의 발현을 조절하는 것으로 알려져 있다32,33). STAT3는 MMP-9의 프로모터에 부착하여 직접적으로 전사를 조절할 수 있으며32), Src은 NF-κB와 같은 전사인자를 활성화시켜 MMP-9의 발현을 조절한다33). 또한 Src은 STAT3의 upstream 키나제로서 STAT3의 전사활성을 조절하여 MMP-9의 발현을 조절할 수도 있다34). 따라서 MEMA에 의한 MMP-9의 발현 감소는 MAPK와 Src/STAT3의 복합적인 조절에 의한 것으로 보인다.

본 연구의 한계점으로서 상백피의 다양한 활성성분 중 어떤 성분이 대장암 세포의 이동 및 침윤을 억제했는지 밝히지 못했다. 기존연구에서 상백피의 성분인 morusin이 STAT3 활성을 억제함으로써 간암세포의 이동과 EMT를 저해한다는 보고가 있으며35), ursolic acid는 STAT3와 ERK 등을 조절하여 대장암과 피부암의 전이를 억제한다고 보고되어 있다36,37). 이들은 공통적으로 MMP-9의 발현을 억제하여 본 연구결과와 유사한 경향을 보였으므로 morusin이나 ursolic acid를 MEMA의 전이억제효과를 나타내는 유효성분으로 상정할 수 있다35,36). MEMA의 분자적 타겟이 무엇인지 명확히 밝히는 것도 추후 연구가 필요한 부분이다, MEMA에 포함된 다양한 활성성분들이 MAPK와 Src/STAT3 경로를 복합적으로 조절했을 것으로 사료되나, 이들의 upstream 타겟이 무엇인지 명확히 밝혀낼 필요가 있다. 예컨대 EGFR과 같은 수용체는 RAS/RAF/MEK/MAPK의 경로를 통해 MAPK를 조절하는 동시에 Src을 통해 STAT3의 활성을 조절할 수 있다38). 본 연구진의 선행 연구 역시 상백피의 주요 활성성분인 morusin이 EGFR을 타겟으로 하여 하위 STAT3 경로를 조절함으로써 폐암세포에 세포사멸을 유도하는 것을 보고한 바 있다39). 따라서 MEMA가 EGFR을 타겟으로 하여 하위 경로를 조절했을 가능성도 존재한다. 그러나 EGFR 이외에 MAPK와 Src/STAT3 경로를 동시에 조절할 수 있는 다양한 수용체 타겟을 MEMA가 어떻게 조절하는지는 향후 더 많은 연구가 필요하다.

결 론

HCT116 인체 대장암 세포주에 상백피 메틸렌클로라이드 추출물(MEMA)을 처리한 결과 다음과 같은 결론을 얻었다. MEMA는 HCT116 세포의 이동능과 침윤능을 농도의존적으로 억제하였으며, MMP-9의 mRNA 및 단백질 발현을 감소시켰다. 또한 MEMA는 MAPK인 ERK, JNK, p38 및 Src/STAT3 경로의 인산화를 현저히 저해하여 이들이 MEMA 활성의 분자적 기전임을 시사하였다. 이러한 결과는 상백피의 대장암에 대한 전이억제효과를 in vitro 수준에서 밝힌 것으로 향후 in vivo 및 임상연구를 통해 호흡기 질환에 국한되어 있던 상백피의 활용범위를 넓히고 한의학의 외연을 확장하는 데 일조할 것으로 사료된다.

Acknowledgments

본 연구는 한국연구재단의 우수신진연구(No. NRF-2021R1C1C100506211)의 사업비로 수행되었음.

References
1. Sung H, Ferlay J, Siegel RL, Laversanne M, Soerjomataram I, Jemal A, et al. Global Cancer Statistics 2020: GLOBOCAN Estimates of Incidence and Mortality Worldwide for 36 Cancers in 185 Countries. CA Cancer J Clin. 2021;71(3):209-49.
2. National Cancer Information Center. Available from: https://www.cancer.go.kr
3. Dekker E, Tanis PJ, Vleugels JLA, Kasi PM, Wallace MB. Colorectal cancer. Lancet. 2019;394(10207):1467-80.
4. Markowitz SD, Bertagnolli MM. Molecular origins of cancer: Molecular basis of colorectal cancer. N Engl J Med. 2009;361(25):2449-60.
5. American Cancer Society. Colorectal Cancer Facts & Figures 2020-2022. Atlanta: American Cancer Society Inc; 2020. p. 11.
6. Rosen L, Jacobs I, Burkes R. Bevacizumab in colorectal cancer: current role in treatment and the potential of biosimilars. Target Oncol. 2017;12:599-610.
7. Hurwitz H, Fehrenbacher L, Novotny W, Cartwright T, Hainsworth J, Heim W, et al. Bevacizumab plus irinotecan, fluorouracil, and leucovorin for metastatic colorectal cancer. N Engl J Med. 2004;350(23):2335-42.
8. Cunningham D, Humblet Y, Siena S, Khayat D, Bleiberg H, Santoro A, et al. Cetuximab monotherapy and cetuximab plus irinotecan in irinotecan-refractory metastatic colorectal cancer. N Engl J Med. 2004;351(4):337-45.
9. Kopetz S, Grothey A, Yaeger R, Van Cutsem E, Desai J, Yoshino T, et al. Encorafenib, Binimetinib, and Cetuximab in BRAF V600E-Mutated Colorectal Cancer. N Engl J Med. 2019;381(17):1632-43.
10. Martinelli E, Troiani T, Sforza V, Martini G, Cardone C, Vitiello PP, et al. Sequential HER2 blockade as effective therapy in chemorefractory, HER2 gene–amplified, RAS wildtype, metastatic colorectal cancer: learning from a clinical case. ESMO Open. 2018;3(1):e000299.
11. The Jointly Published Textbook Compilation Committee of Oriental College of Medicine Nationwide Department. Herbology. Seoul: Younglim press; 2004.
12. Chan EW, Lye PY, Wong SK. Phytochemistry, pharmacology, and clinical trials of Morus alba. Chin J Nat Med. 2016;14(1):17-30.
13. Lim HJ, Jin HG, Woo ER, Lee SK, Kim HP. The root barks of Morus alba and the flavonoid constituents inhibit airway inflammation. J Ethnopharmacol. 2013;149(1):169-75.
14. Lee HJ, Ryu J, Park SH, Woo ER, Kim AR, Lee SK, et al. Effects of Morus alba L. and Natural Products Including Morusin on In Vivo Secretion and In Vitro Production of Airway MUC5AC Mucin. Tuberc Respir Dis (Seoul). 2014;77(2):65-72.
15. Kim HJ, Lee HJ, Jeong SJ, Lee HJ, Kim SH, Park EJ. Cortex Mori Radicis extract exerts antiasthmatic effects via enhancement of CD4(+)CD25(+)Foxp3(+) regulatory T cells and inhibition of Th2 cytokines in a mouse asthma model. J Ethnopharmacol. 2011;138(1):40-6, 2011.
16. El-Beshbishy HA, Singab AN, Sinkkonen J, Pihlaja K. Hypolipidemic and antioxidant effects of Morus alba L. (Egyptian mulberry) root bark fractions supplementation in cholesterol-fed rats. Life Sci. 2006;78(23):2724-33.
17. Du J, He ZD, Jiang RW, Ye WC, Xu HX, But PPH. Antiviral flavonoids from the root bark of Morus alba L. Phytochemistry. 2003;62(8):1235-8.
18. Park SH, Chi GY, Eom HS, Kim GY, Hyun JW, Lee SJ, et al. Role of autophagy in apoptosis induction by methylene chloride extracts of Mori cortex in NCI-H460 human lung carcinoma cells. Int J Oncol. 2012;40(6):1929-40.
19. Min TR, Park HJ, Park MN, Kim B, Park SH. The root bark of Morus alba L. suppressed the migration of human non-smallcell lung cancer cells through inhibition of epithelial-mesenchymal transition mediated by STAT3 and Src. Int J Mol Sci. 2019;20(9):2244.
20. Kikuchi T, Nihei M, Nagai H, Fukushi H, Tabata K, Suzuki T, et al. Albanol A from the root bark of Morus alba L. induces apoptotic cell death in HL60 human leukemia cell line. Chem Pharm Bull (Tokyo). 2010;58(4):568-71.
21. Eo HJ, Park JH, Park GH, Lee MH, Lee JR, Koo JS, et al. Anti-inflammatory and anti-cancer activity of mulberry (Morus alba L.) root bark. BMC Complement Med Ther. 2014;14:200.
22. Kwon YH, Bishayee K, Rahman A, Hong JS, Lim SS, Huh SO. Morus alba accumulates reactive oxygen species to initiate apoptosis via FOXO-caspase 3-dependent pathway in neuroblastoma cells. Mol Cells. 2015;38(7):630-7.
23. Park HJ, Chi GY, Choi YH, Park SH. The root bark of Morus alba L. regulates tumor-associated macrophages by blocking recruitment and M2 polarization of macrophages. Phytother Res. 2020;34(12):3333-44.
24. Krakhmal NV, Zavyalova MV, Denisov EV, Vtorushin SV, Perelmuter VM. Cancer Invasion: Patterns and Mechanisms. Acta Naturae. 2015;7(2):17-28.
25. Stamenkovic I. Matrix metalloproteinases in tumor invasion and metastasis. Semin Cancer Biol. 2000;10(6):415-33.
26. Braicu C, Buse M, Busuioc C, Drula R, Gulei D, Raduly L, et al. A Comprehensive Review on MAPK: A Promising Therapeutic Target in Cancer. Cancers (Basel). 2019;11(10):1618.
27. Zhang S, Yu D. Targeting Src family kinases in anti-cancer therapies: Turning promise into triumph. Trends Pharmacol Sci. 2012;33(3):122-8.
28. Kamran MZ, Patil P, Gude RP. Role of STAT3 in Cancer Metastasis and Translational Advances. BioMed Res Int. 2013;2013:421821.
29. Cheng CY, Hsieh HL, Hsiao LD, Yang CM. PI3-K/Akt/JNK/NF-kappaB is essential for MMP-9 expression and outgrowth in human limbal epithelial cells on intact amniotic membrane. Stem Cell Res. 2012;9(1):9-23.
30. Simon C, Simon M, Vucelic G, Hicks MJ, Plinkert PK, Koitschev A, et al. The p38 SAPK pathway regulates the expression of the MMP-9 collagenase via AP-1-dependent promoter activation. Exp Cell Res. 2001;271(2):344-55.
31. Cho A, Graves J, Reidy MA. Mitogen-activated protein kinases mediate matrix metalloproteinase-9 expression in vascular smooth muscle cells. Arterioscler Thromb Vasc Biol. 2000;20(12):2527-32.
32. Jia ZH, Jia Y, Guo FJ, Chen J, Zhang XW, Cui MH. Phosphorylation of STAT3 at Tyr705 regulates MMP-9 production in epithelial ovarian cancer. PLoS One. 2017;12(8):e0183622.
33. Liu JF, Chen PC, Chang TM, Hou CH. Thrombospondin-2 stimulates MMP-9 production and promotes osteosarcoma metastasis via the PLC, PKC, c-Src and NF-kappaB activation. J Cell Mol Med. 2020;24(21):12826-39.
34. Schindler C, Levy DE, Decker T. JAK-STAT Signaling: From Interferons to Cytokines. J Biol Chem. 2007;282(28):20059-63.
35. Lin WL, Lai DY, Lee YJ, Chen NF, Tseng TH. Antitumor progression potential of morusin suppressing STAT3 and NFB in human hepatoma SK-Hep1 cells. Toxicol Lett. 2015;232(2):490-8.
36. Prasad S, Yadav VR, Sung B, Reuter S, Kannappan R, Deorukhkar A, et al. Ursolic Acid Inhibits Growth and Metastasis of Human Colorectal Cancer in an Orthotopic Nude Mouse Model by Targeting Multiple Cell Signaling Pathways: Chemosensitization with Capecitabine. Clin Cancer. 2012;18(18):4942-53.
37. Liu P, Du R, Yu X. Ursolic Acid Exhibits Potent Anticancer Effects in Human Metastatic Melanoma Cancer Cells (SK-MEL-24) via Apoptosis Induction, Inhibition of Cell Migration and Invasion, Cell Cycle Arrest, and Inhibition of Mitogen-Activated Protein Kinase (MAPK)/ERK Signaling Pathway. Med Sci Monit. 2019;25:1283-90.
38. Mosesson Y, Yarden Y. Oncogenic growth factor receptors: implications for signal transduction therapy. Semin Canc Biol. 2014;14(4):262-70.
39. Park HJ, Min TR, Chi GY, Choi YH, Park SH. Induction of apoptosis by morusin in human non-small cell lung cancer cells by suppression of EGFR/STAT3 activation. Biochem Biophys Res Commun. 2018;505(1):194-200.
 
Department of Pathology, College of Korean Medicine, Wongkwang University, 460, Iksan-daero, Iksan-si, Jeollabuk-do, 570-749, Korea
TEL: +82-63-850-6835, FAX: +82-63-856-6843
E-mail: herb1@wku.ac.kr