Journal Archive

Journal of Physiology & Pathology in Korean Medicine - Vol. 34 , No. 2

[ ORIGINAL ARTICLES ]
Journal of Physiology & Pathology in Korean Medicine - Vol. 34, No. 2, pp.67-74
Abbreviation: J Physiol & Pathol Korean Med
ISSN: 1738-7698 (Print) 2288-2529 (Online)
Print publication date 25 Apr 2020
Received 09 Mar 2020 Revised 03 Apr 2020 Accepted 13 Apr 2020
DOI: https://doi.org/10.15188/kjopp.2020.04.34.2.67

지모 추출물의 피부 미백 및 항산화 효과 연구
최찬헌* ; 정현우
동신대학교 한의과대학

Study on Skin Whitening and Antioxidant Effect of Anemarrhenae Rhizoma Extract
Chanhun Choi* ; Hyun Woo Jeong
College of Korean Medicine, Dongshin University
Correspondence to : *Chan hun Choi, College of Korean Medicine, Dongshin University, 185, Geonjae-ro Naju-si Jeollanam-do, Republic of Korea ·E-mail : mensolog@dsu.ac.kr ·Tel : +82-61-330-3515


Ⓒ The Society of Pathology in Korean Medicine, The Physiological Society of Korean Medicine
Funding Information ▼

Abstract

The objective of this study is to investigate the skin whitening and antioxidant effects of the Anemarrhenae Rhizoma extract (ARE). Following the previously studied method, we examined the inhibitory effects of melanin synthesis and tyrosinase activity by using B16F10 cells. First, we measured the Diphenylpicrylhydrazyl (DPPH) assay, nitrite scavenging activity, and superoxide dismutase-like activity to verifying antioxidant efficacy according to skin whitening. In addition, we confirmed the skin whitening efficacy of ARE by measuring gene expression associated with a skin whitening by the Reverse transcription polymerase chain reaction (RT-PCR) method in B16F10 cells. In this study, we confirmed that ARE has skin whitening and antioxidant effects at high concentrations. In particular, ARE at a concentration of 500 ㎍/ml inhibited the expression of Tyrosinase, TRP-2 (tyrosinase-related protein), and MITF (microphthalmia transcription factor) genes better than Arbutin. In conclusion, our results confirmed that ARE has the potential for development as a skin whitening efficacy substance.


Keywords: Anemarrhenae Rhizoma, Melanin, Tyrosinase, Skin whitening, Antioxidant

서 론

의학기술 발전과 생활 수준은 향상되고 있으나 심각한 환경오염으로 인해 피부 손상은 지속적으로 증가되고 있어 피부미용에 대한 관심이 고조되고 있다1). 이러한 경향으로 기능성 화장품의 수요 증가 및 시장 규모가 확대됨에 따라 천연물 성분들의 약리적 기능을 과학적으로 입증하고 이를 기능성 화장품으로 개발하려는 움직임이 활발히 진행되고 있다2). 이러한 결과물로 식품의약품안전처의 기능성 인증 항목 중 화장품의 기능성 연구가 주로 피부 미백효과에 집중되어 있으며3) 특히, 화학성분의 미백제와 약물에 대한 부작용으로 인체에 부작용이 적은 천연물질을 이용한 멜라닌 생성억제 및 활성산소 소거 기능을 가진 피부 미백 소재 개발이 증가하고 있다4).

지모(知母, Anemarrhenae Rhizoma)는 기원 식물인 지모(Anemarrhena asphodeloide)의 뿌리줄기를 사용하고 있으며5), 약리활성을 갖는 nyasol (암세포 증식억제), mangiferin, neomangiferin (NO 및 PGE2 생성억제)을 지표성분으로 활용하고 있다6).

한의학적 관점에서 지모는 寒하고 苦甘하여 肺․腎․胃經으로 귀경하여 대표적으로 熱瀉火·生津潤燥5)의 효능 있고, 해열, 강심, 이뇨, 항균, 거담, 진정, 혈당강하, 항암 등의 약리작용이 있다고 보고되었다7,8).

지모에 대한 미용 기능성 연구로 이 등9)은 지모 추출물을 제조하여 피부 상재균에 대한 항균활성, 항산화 효능 및 세포보호활성을 측정하여 천연 화장품 소재로서의 가능성을 확인하였고, 박 등10)은 지모 추출물에서 MPLC와 연계한 활성유도 분획법을 이용하여 항염 효과를 가지는 물질이 있음을 확인하고 해당 활성 단일화합물을 통해 항염증, 피부 미백, 항아토피 효과 등의 약리적 미용 활성을 탐색하여 천연 기능성화장품 소재로서의 가능성을 보고하였다. 또한 권 등11)은 지모의 70% MeOH 추출물 및 각 분획물에 대하여 강한 라디칼 소거능 및 pancreatic lipase 저해능의 결과를 보고하였다.

지모에 대한 기존 연구9-11)의 경우 에탄올 추출을 통해 nyasol 등의 단일화합물을 분리하고 이를 항염증, 피부 미백, 항아토피에 대한 지표를 관찰한 것으로써, 이 중 피부 미백과 관련된 지표는 melanin 생합성 저해 활성과 tyrosinase 저해 활성에 대한 관찰에 한정되어 있다. 본 연구에서는 지모 추출물의 기능성 화장품 소재로서의 가능성을 검토하기 위하여 기존의 연구들을 기반으로 지모의 피부 미백효과에 대한 심층적인 연구기법과 함께 RT-PCR을 활용하여 지모 열수추출물의 melanin 생합성율과 tyrosinase 활성 저해효과, 그리고 PCR을 활용하여 지모 추출물이 tyrosinase, TRP-2, MITF의 발현에 미치는 영향을 관찰하였다. 아울러 피부 미백효과와 연관된 항산화 효능을 DPPH 및 아질산염 소거능, Superoxide dismutase (SOD) 유사활성도 관찰을 통해 측정한 결과를 보고하자고 한다.


재료 및 방법
1. 시료 제조

중국 호북성 원산지인 지모(검사처 : 한약진흥재단)를 G광역시의 G한약전문 도매업체에서 공급받아 사용했다. 시료는 지모 100 g에 증류수 1,500 ㎖으로 전기약탕기(Deawoong, Korea)로 120 분간 전탕 후 거즈로 거르고 원심분리기(Eppendrof, Germany)를 이용하여 3,000 rpm에서 15 분간 원심분리하여 상층액을 얻었다. 이 상층액을 감압농축기(EYELA, Japan)를 이용하여 감압 농축 후 동결건조기(Ilshin, Korea)를 이용하여 최종적으로 지모 동결건조 추출물 39.5 g (수득율 39.5%)을 획득하여 사용하였다.

2. 세포주

실험에 사용된 악성 흑색종(melanoma) 세포주인 B16F10 cell은 한국세포주은행(Korean Cell Line Bank, Korea)에서 구입하였다. B16F10 세포주의 생육 배지는 DMEM (Gibco, USA)을 사용하였고, 배지에 10% fetal bovine serum (Gibco, USA)와 Antibiotic-Antimycotic (Gibco, USA)을 첨가하였고, 37℃, 5% CO2 incubator에서 배양하였다.

3. 세포 생존율 측정

세포 생존율은 EZ-Cytox Assay kit (Dogenbio, Korea)를 사용하여 측정하였다. B16F10 세포를 배양한 후 96 well plate에 각 well당 5×104 cells/well 농도로 분주하고, 37℃, 5% CO2 incubator에서 24시간 동안 배양한다. 이후 지모 추출물을 농도별(0, 62.5, 125, 250, 500, 1,000 ㎍/㎖)로 처리한 후 24시간 배양하고 EZ-Cytox용액 10 ㎕를 각 well에 처리한다. 2시간 가량 배양 후 Microplate Reader (Bio-rad, USA)를 사용하여 450 ㎚에서 흡광도를 측정하였다.

4. 멜라닌 생합성율 측정

멜라닌 생성율 측정은 Hosoi 등의 방법12)을 참고하였다. B16F10 세포주를 배양하여 24 well plate에 각 well 당 3×104 cells/well 농도로 분주하고 24시간을 배양 후 지모 추출물을 농도별(0, 62.5, 125, 250, 500, 1,000 ㎍/㎖)로 처리한 후 37℃, 5% CO2 incubator에서 48시간 배양하였다. 이 후 각 well를 PBS로 세척한 후 1N NaOH 용액 400 ㎕을 첨가하고 60℃에서 1 시간 동안 용해 후 Microplate Reader를 사용하여 405 ㎚에서 측정하였다. α-MSH (α-melanocyte stimulating hormone)으로 촉진된 멜라닌 생합성 효능은 지모 추출물을 농도별로 37℃, 5% CO2 incubator에서 1시간 배양하고 α-MSH 100 nM를 처리한 후 37℃, 5% CO2 incubator에서 48시간 배양하였다. 이후 각 well를 PBS로 세척한 후 1 N NaOH 용액 400 ㎕을 첨가하고 60℃에서 1시간 동안 용해한 후 Microplate Reader를 사용하여 405 ㎚에서 측정하였다.

5. Tyrosinase 활성율 측정

Tyrosinase 활성에 미치는 영향은 Yagi 등의 방법13)을 이용해 측정하였다. 10 mM L-DOPA 용액 0.2 ㎖와 sodium phosphate buffer (pH 6.5) 0.5 ㎖를 가한 후 buffer에 녹이고 최종농도(0, 62.5, 125, 250, 500, 1,000 ㎍/㎖)가 되도록 하고 mushroom tyrosinase (110 unit/㎖) 0.2 ㎖를 첨가하여 37℃ 에서 2 분간 반응시킨 후 Microplate Reader를 사용하여 475 ㎚에서 흡광도를 측정하였고 저해율은 다음과 같이 계산하였다.

Tyrosinase inhibition%=1-1-B-CA-D×100
· A : 효소만 첨가된 반응 용액
· B : 효소와 시료가 모두 첨가된 반응 용액
· C : 시료만 첨가된 반응 용액
· D : 효소와 시료가 모두 첨가되지 않은 반응 용액

6. RT-PCR 측정

RT-PCR (Reverse transcription Polymerase chain reaction)을 이용하여 ARE가 tyrosinase, TRP-2, MITF 발현 양에 미치는 효과를 알기 위해 ARE 500 ㎍/㎖와 arbutin 500 ㎍/㎖를 1시간 후 처리하였다. α-MSH 100 nM를 처리하고 37℃, 5% CO2 incubator에서 24 시간 배양한 후 세포를 1% Triton X-100을 함유한 10 mM PBS 100 ㎕에 현탁시킨 후 세포를 vortexing하고 1,000 rpm에서 5 분 원심분리하여 상층액을 활성 측정 효소액으로 사용하였다.

Total RNA 분리는 분화가 완료된 B16F10 cell의 배지를 제거하고 PBS로 세척한 다음 800㎕ TRIZOL reagent (Gibco-BRL, USA)를 처리하여 cell를 용해시켰다. 용해된 용액에 200㎕의 chroloform을 분주하고 15초간 vortexing한 후 4℃, 13,000 rpm에서 5분간 원심분리하여 상층액만 분리한 다음 500 ㎕의 isopropanol (Sigma, USA)을 첨가하여 실온상태에서 5 분간 방치한 후 RNA를 분리하기 위해 4℃, 13,000 rpm에서 5 분간 원심분리하였다. 원심분리로 만든 pellet에 냉장보관된 70% ethanol과 함께 DEPC-treated water (Biosolution, Korea)를 넣고 4℃, 13,000 rpm에서 5 분간 원심분리 후 pellet만 남기고 모두 제거한다. 남은 ethanol은 실온에서 10 분간 방치하여 건조시킨 후 DEPC-treated water에 녹여 Biophotometer (Eppendorf, Germany)에서 260 ㎚에서 OD260 값을 구해 RNA의 농도를 정량한다. 분리되어진 total RNA 1 μg를 Mastercycler gradient (Eppendorf, Germany)를 이용하여 50 ㎕ cDNA로 합성하여 PCR 증폭을 위한 template로 사용하였다. cDNA, sense primer, antisense primer, DEPC-treated water를 PCR premix (Bioneer, Korea)에 넣었고 Mastercycler gradient (Eppendorf, Germany)에서 cDNA를 증폭하였고, 실험에 사용된 primer 종류와 sequences는 아래 Table 1과 같다.

Table 1. 
List of primer sequences used for RT-PCR analysis
Primer annealing temp(℃) Sense Antisense
Tyrosinase 57℃ CCTCCTGGCAGATCATTTGT GGCAAATCCTTCCAGTGTGT
TRP-2 62℃ GGCCAGCTTTCAGGCAGAGGT CGGTTGTGACCAATGGGTGCC
MITF 58℃ TAGACATGCCAGCCAAGTCC CGCTGTGAGCTCCCTTTTTA
GAPDH 58℃ ACCACAGTCCATGCCATAAC TCCACCACCCTGTTGCTGTA

7. DPPH 라디칼 소거능

DPPH 라디칼 소거능은 Blois15)의 방법을 응용하였다. DPPH 용액은 100 ㎖ 에탄올에 DPPH 0.15 mM을 녹인 후 증류수와 혼합하여 filtering하여 제조하였다. 96 well plate에 시료와 DPPH 용액을 1:4 비율로 혼합하여 37℃에서 30 분간 반응시킨후, Microplate Reader를 이용하여 520 nm에서 흡광도를 측정하였고, DPPH 라디칼소거능은 A-BA×100 으로 계산하였다.

· A : 대조구 흡광도
· B : 시료첨가구 흡광도

8. 아질산염 소거능

아질산염 소거 작용은 Kato 등16)의 방법을 변형하여 측정하였다. 1 mM의 NaNO2 용액 1 ㎖에 시료 1 ㎖를 첨가하고, 0.1 N HCL 9 ㎖을 첨가한 후 37℃에서 1 시간 동안 반응시켰다. 반응액 1 ㎖에 2% acetic acid 5 ㎖를 첨가하고, Griess reagent 0.4 ㎖를 참가하여 혼합시킨 후 실온에서 차광상태로 15 분간 방치시킨 후 Microplate Readerr를 이용하여 520 nm에서 흡광도를 측정하였다. 아질산염 소거능은 1-A-CB×100 으로 계산하였다.

· A: NaNO2 용액에 시료와 Griess를 첨가한 흡광도
· B: NaNO2 용액에 Griess를 첨가한 흡광도
· C: NaNO2 용액에 시료와 증류수를 첨가한 흡광도

9. Superoxide dismutase 유사활성도 측정

SOD 유사활성도는 Marklund 등의 방법14)에 따라 활성산소종을 과산화수소(H2O2)로 전환하는 반응을 촉매하는 pyrogallol의 생성량을 측정하여 SOD 유사활성을 나타내었다. 농도(0, 62.5, 125, 250, 500, 1,000 ㎍/㎖)별로 지모 추출물을 buffer에 녹여 10 ㎕씩 96 well plate에 첨가 후, 7.2 mM pyrogallol 10 ㎕와 Tris-HCl Buffer(50 mM Tris aminomethane, 10 mM EDTA, pH 8.0) 150 ㎕을 첨가한다. 실온에서 10 분간 반응시킨 후 1 N HCl 50 ㎕을 첨가하여 반응을 정지시킨다. 이후 Microplate Reader를 이용하여 420 ㎚에서 흡광도를 측정하였고, SOD 유사활성도는 SOD%=1-AB×100 으로 계산하였다.

· A : 추출물 첨가구의 흡광도
· B : 추출물 무첨가구의 흡광도

10. 통계처리

데이터의 통계적 유의성 검증은 IBM® SPSS® Statistics (Ver. 25.0)을 활용하였다. 군 간의 평균 비교는 one-way ANOVA로 유의성을 확인하였고, 사후검증으로는 Tukey 방법을 사용하였으며, p 값이 0.05 미만인 경우에만 유의성이 있는 것으로 판단하였다.


결 과
1. 세포 생존율

지모 추출물(Anemarrhenae Rhizoma Extract, ARE)이 B16F10 세포의 생존율에 미치는 영향을 관찰한 결과 ARE를 처리한 모든 농도에서 유의성 있는 생존율의 변화를 관찰할 수 없었다(Table 2, Fig. 1).

Table 2. 
The effects of ARE on cell viability rates in B16F10 cells
Concentration
(㎍/㎖, n=8)
0 62.5 125 250 500 1,000
Cell viability rate(%) Mean 100.00 99.85 98.17 99.44 103.22 106.31
SD 4.33 6.17 7.40 6.78 4.95 7.46


Fig. 1. 
The effects of ARE on cell viability rates in B16F10 cells. The X-axis represents the concentration of the ARE. The graph shows the mean and standard deviation (n=8).

2. 멜라닌 생성 억제 효과

지모 추출물(ARE)이 melanin 생성 억제에 미치는 효과를 관찰한 결과 저농도 처리군에서는 melanin 생성이 억제되었으나 유의한 차이는 보이지 않았고, ARE 250 ㎍/㎖ 처리군에서부터 melanin 생성이 유의하게 감소되었다(Table 3, Fig. 2).

Table 3. 
The inhibitory effects of ARE on melanin production in B16F10 cells
Concentration
(㎍/㎖, n=4)
0 62.5 125 250 500 1,000
Melanin production rate(%) Mean 100.0 91.6 87.7 85.5 85.5 83.3
SD 5.82 6.75 7.10 6.51 4.19 4.41


Fig. 2. 
The inhibitory effects of ARE on melanin production in B16F10 cells. The X-axis represents the concentration of the ARE. The graph shows the mean and standard deviation(n=4). * : Statistically significance compared with group “0” (Non-treated group) (*; p<0.05, ** ; p<0.01).

3. α-MSH에 의해 촉진된 melanin 억제 효과

Melanin 생합성을 α-MSH (α-melanocyte stimulating hormone)로 촉진시킨 후 ARE의 억제효과를 관찰한 결과 농도 의존적으로 melanin 생성이 감소하였고 500 ㎍/㎖ 농도부터 통계적인 유의성이 관찰되었다(Table 4, Fig. 3).

Table 4. 
The inhibitory effects of ARE on melanin production in α-MSH stimulated B16F10 cells
Concentration
(㎍/㎖, n=4)
0 62.5 125 250 500 1,000
Melanin production rate(%) Mean 100.00 91.45 88.89 83.76 79.91 78.21
SD 9.31 10.11 9.57 7.77 8.18 7.03


Fig. 3. 
The inhibitory effects of ARE on melanin production in α-MSH stimulated B16F10 cells. The X-axis represents the concentration of the ARE. The graph shows the mean and standard deviation(n=8). * : Statistically significance compared with group “0” (Non-treated group) (*; p<0.05).

4. Tyrosinase 억제 효과

ARE의 tyrosinase 활성 억제 효과를 측정한 결과 저농도군에서는 거의 효과가 나타나지 않았으나 500 ㎍/㎖와 1,000 ㎍/㎖ 군에서 통계적으로 유의하게 tyrosinase 활성을 억제하는 것이 관찰되었다(Table 5, Fig. 4).

Table 5. 
The tyrosinase inhibitory effects of ARE in vitro
Concentration
(㎍/㎖, n=4)
0 62.5 125 250 500 1,000
Tyrosinase inhibition rate(%) Mean 100.00 98.95 98.46 99.75 94.31 83.49
SD 0.00 1.96 1.25 2.51 0.73 1.60


Fig. 4. 
The tyrosinase inhibitory effects of ARE in vitro. The X-axis represents the concentration of the ARE. The graph shows the mean and standard deviation(n=8). * : Statistically significance compared with group “0” (Non-treated group) (**; p<0.01).

5. Tyrosinase 발현

α-MSH로 tyrosinase 촉진시킨 후의 tyrosinase 발현에 미치는 영향을 관찰하기 위해 α-MSH을 처리하고 시료를 투여하지 않은 군을 Control군으로 설정하고, α-MSH 처리 후 Arbutin과 ARE 500 ㎍/㎖ 처리한 군을 각각 Arbutin군과 ARE군으로 설정한 후 PCR 발현 양상을 관찰할 결과 Arbutin군과 ARE군 모두에서 Control군에 비해 유의성 있게 억제되었다(Fig. 5).


Fig. 5. 
The effect of ARE on tyrosinase level observed through PCR. Normal: Not treated with α-MSH and extract; Control: α-MSH treatment Group; Arbutin: α-MSH 100 nM & Arbutin 500㎍/㎖ Treatment Group; ARE: α-MSH 100 nM & ARE 500㎍/㎖ Treatment Group (n=4). *: Statistically significance compared with Control group(**; p<0.01).

6. TRP-2 발현

TRP-2 발현에 미치는 영향을 관찰한 결과 Arbutin군과 ARE군 모두가 Control군에 비해 통계적으로 감소하였으며 ARE군이 Arbutin군에 비해 감소폭이 컸다(Fig. 6).


Fig. 6. 
The effect of ARE on TRP-2 level observed through PCR. Normal: Not treated with α-MSH and extract; Control: α-MSH treatment Group; Arbutin: α-MSH 100 nM & Arbutin 500㎍/㎖ Treatment Group; ARE: α-MSH 100 nM & ARE 500㎍/㎖ Treatment Group (n=4). *: Statistically significance compared with Control group (*; p<0.05, **; p<0.01).

7. MITF 발현

MITF 발현에 미치는 영향을 관찰한 결과 Arbutin군 ARE군 모두 Control군에 비해 감소하였으며 통계적으로 Arbutin군은 유의한 수준은 아니였고, ARE군만 통계적으로 유의했다(Fig. 7).


Fig. 7. 
The effect of ARE on TRP-2 level observed through PCR. Normal: Not treated with α-MSH and extract; Control: α-MSH treatment Group; Arbutin: α-MSH 100 nM & Arbutin 500㎍/㎖ Treatment Group; ARE: α-MSH 100 nM & ARE 500㎍/㎖ Treatment Group (n=4). *: Statistically significance compared with Control group ( **; p<0.01).

8. DPPH 소거능

ARE의 DPPH radical 소거능을 관찰한 결과 free radical 소거 활성이 농도의존적으로 유의하게 증가하는 것으로 관찰되었다(Table 6, Fig. 8).

Table 6. 
The free radical scavenging activity of ARE.
Concentration
(㎍/㎖, n=8)
62.5 125 250 500 1,000
Free radical scavenging activity(%) Mean 28.06 39.25 50.51 62.03 71.17
SD 4.37 4.22 4.275 5.449 2.101


Fig. 8. 
The free radical scavenging activity of ARE. The X-axis represents the concentration of the ARE. The graph shows the mean and standard deviation(n=8). * : Statistically significance compared with “62.5” group (**; p<0.01).

9. 아질산염 소거능

ARE의 아질산염 소거능을 관찰한 결과 소거 활성이 농도의존적으로 유의하게 증가하는 것으로 관찰되었다(Table 7, Fig. 9).

Table 7. 
The Nitrite-scavenging activity of ARE.
Concentration
(㎍/㎖, n=8)
62.5 125 250 500 1,000
Nitrite-scavenging activity(%) Mean 10.60 31.98 35.68 36.22 41.41
SD 2.82 2.59 3.47 2.16 2.78


Fig. 9. 
The Nitrite-scavenging activity of ARE. The X-axis represents the concentration of the ARE. The graph shows the mean and standard deviation(n=8). * : Statistically significance compared with “62.5” group (**; p<0.01).

10. Superoxide dismutase 유사활성

ARE이 SOD 유사활성에 미치는 효과를 관찰해 본 결과 250 ㎍/㎖까지는 농도의존적으로 증가하는 경향을 보였으나 500 ㎍/㎖ 이상의 고농도에서는 감소하는 경향을 보였다. 500과 1,000 ㎍/㎖의 경우 125 ㎍/㎖에 비해 유의하게 감소하였음을 관찰할 수 있었다(Table 8, Fig. 10).

Table 8. 
The SOD-like activity of depending on concentration.
Concentration
(㎍/㎖, n=8)
62.5 125 250 500 1,000
SOD-like activity(%) Mean 17.50 25.38 23.74 17.46 15.54
SD 4.23 5.17 4.71 3.77 3.13


Fig. 10. 
The SOD-like activity of depending on concentration. The X-axis represents the concentration of the ARE. The graph shows the mean and standard deviation(n=8). * : Statistically significance compared with “62.5” group (**; p<0.01).


고 찰

세계적으로 친환경 붐을 타고 천연 소재를 활용한 기능성 원료 개발 연구가 활발히 진행되고 있으며3) 그 중 한약재는 그 자체로서 생약제제의 원료뿐만 아니라 각종 신약개발 소재 등으로 그 수요가 증가하고 있다6).

식약처에서는 안정성과 안전성이 확보되고 다양한 연구를 통해 효과가 입증된 원료에 대해서는 연구 결과를 반영하여 기능성 원료로 고시하고 있지만17), 피부 미백에 대한 효능과 안정성 및 안전성이 검토되어 고시된 닥나무추출물17,18), Arbutin, niacinamide19,20)의 경우처럼 법적으로 고시된 기능성 원료들도 실제 사용에서 문제점들이 발견되고 있어 고시된 피부 미백 기능성 원료와 비교하여 효능이 더 우수하거나 최소한 비슷한 효과를 가지면서 안정성과 안전성이 확보된 새로운 피부 미백제의 발굴이 필요한 실정이다3).

지모는 민간에서도 널리 사용되어 왔고, saponin 계열을 중심으로 한 성분연구와 norlignan 계열의 활성연구도 활발하게 진행되었으며, 재배 지역에 따라 성분이 달라지고 있다는 보고6)와 함께 계속해서 많은 활성 물질의 연구가 진행되고 있다. 지모 추출물 및 분획물을 이용하여 기능성 화장품 소재 적용을 위한 다양한 종류의 항균활성 평가나 총 항산화능 평가 그리고 세포 보호 효과에 대한 연구9-11)가 진행되었으나 피부 미백을 중심으로 심도 있는 진행한 연구는 미흡한 실정이었다. 이에 저자들은 지모가 피부 미백에 활용될 수 있는 기능성 소재로서 활용 가능성을 바탕으로 피부 미백 효과에 대한 근거 및 이론적 뒷받침을 보충하는 것이 필요하다고 판단하였고, 심도 있는 연구를 기획하였다. 이를 위해 악성 흑색종 세포주(B16F10)를 이용하여 세포 생존율과 melanin 생합성율 및 tyrosinase 합성 저해효과를 관찰하였고, PCR을 활용하여 지모추출물과 양성대조군으로 Arbutin을 설정하고 tyrosinase, TRP-2, MITF의 발현에 미치는 영향을 관찰하였다. 아울러 지모 추출물의 항산화 효능을 DPPH과 아질산염 소거능, SOD 유사활성도를 통해 관찰하여 지모의 피부 미백효과 기능성 소재로서의 개발 가능성을 타진해 보고자 하였다.

지모 추출물(ARE) 투여에 따른 B16F10 세포의 생존율을 관찰한 결과 최고 농도(1000 ㎍/㎖)까지 특별한 세포 독성을 보이지 않았다(Table 2, Fig. 1). 이를 바탕으로 향후 실험에서 ARE의 농도를 1,000 ㎍/㎖까지 처리하였으며, RT-PCR에서는 여러 지표에서 효능이 두드러지는 500 ㎍/㎖를 처리하기로 결정하였다. ARE의 melanin 생성 억제 효과를 관찰한 결과 ARE 투여가 따라 농도의존적으로 melanin 생성이 억제되는 경향이 보였으나 저농도 처리군에서는 유의한 차이는 보이지 않았고, ARE 250 ㎍/㎖ 처리군에서부터 melanin 생성이 유의하게 감소되는 것으로 관찰되었다(Table 3, Fig. 2). Adenylate cyclase를 활성화 시켜 tyrosinase의 발현과 활성을 유도를 통해 melanin 생성을 촉진하는 α-MSH (α-melanocyte stimulating hormone)21)를 투여한 후의 결과를 살펴보면 ARE 처리를 통해 농도의존적으로 melanin 생성이 감소하는 경향이 보였고, 500, 1,000 ㎍/㎖ 농도에서 통계적인 유의성을 관찰할 수 있었다(Table 4, Fig. 3). 이러한 농도의존적으로 감소 추세를 보이는 결과를 통해 높은 농도에서 ARE가 멜라닌 생성 억제효과가 있음을 확인하였다.

Melanin 합성에 가장 크게 관여하면 피부 미백제 개발에 있어서 중요한 지표를 활용되는21,22) tyrosinase 억제 효과를 관찰한 결과 62.5 ㎍/㎖, 125 ㎍/㎖, 250 ㎍/㎖ 투여군에서는 거의 변화가 나타나지 않았으나 500 ㎍/㎖와 1,000 ㎍/㎖ 군에서 통계적으로 유의한 수준으로 tyrosinase 활성을 억제하는 것이 관찰되었다(Table 5, Fig. 4).

Tyrosinase와 함께 대표적인 tyrosinase related protein으로 발현이 억제되면 피부 미백효과를 기대할 수 있는 TRP-223)과 MITF (microphthalmia transcription factor)24)의 발현을 α-MSH 처리한 후 양성대조군으로 Arbutin을 설정하여 PCR를 통해 비교 관찰하였다. Arbutin은 환원성이 강한 페놀류의 방향족 유기화합물로 강한 환원성으로 인해, 멜라닌 형성에 중요한 효소인 tyrosinase의 효소활성을 억제하여 멜라닌 합성을 억제하는 능력이 우수하여 피부 미백고시원료로 사용되고 있다25).

결과를 살펴보면 tyrosinase과 TRP-2 발현에 미치는 영향은 α-MSH만을 처리한 Control군에 비해 양성대조군인 Arbutin군과 ARE군 모두에서 유의하게 억제하는 것으로 관찰되었으며, Arbutin군과 ARE군 비교에서도 ARE군이 우수한 것으로 관찰되었다(Fig. 5-6). MITF 발현의 경우에서는 Control군에 비해 양성대조군인 Arbutin군과 ARE군 모두 발현을 억제시키는 경향을 보였으나 통계적 유의성은 ARE군에서만 관찰되어(Fig. 7) PCR 결과에 있어서는 양성대조군인 Arbutin과 비교에서도 더 우수한 효과를 보였다. MITF는 TRP-2의 promoter에 결합하여 유전자 발현을 증가시켜 melanogenesis를 유도하므로 결과적으로 MITF의 억제는 TRP-2 역시 발현을 억제시켜 이를 통해 melanin 생성을 억제하는24) 기전을 통해 지모 추출물이 멜라닌 생성 억제 작용을 한다고 판단할 수 있다.

자외선 노출은 피부 손상과 노화에 영향을 주는 대표적 외부 요인으로 과색소 침착, 과염증 유발, 활성산소종(reactive oxygen species, ROS)의 비정상적 생산 증가와 연관되며6), 활성산소가 생성되게 되면 이들의 높은 반응성으로 생체막에서 자동산화과정 및 지질과산화를 경유한 연쇄반응으로 생체 구성성분들을 산화적 손상을 일으키므로26) 피부 기능성 소재로서의 항산화 효능은 중요한 지표이다. ARE의 항산화 효능을 검증하기 위하여 DPPH radical 소거능, 아질산염 소거능, SOD 유사활성도를 측정하였다. 그 결과 DPPH radical과 아질산염 소거능 활성은 농도의존적으로 유의하게 증가하는 것으로 관찰되었고(Table 6-7, Fig. 8-9), SOD (Superoxide dismutase) 유사활성에서는 250 ㎍/㎖까지는 농도의존적으로 증가하는 경향을 보였으나 500 ㎍/㎖ 이상의 고농도에서는 감소하는 경향을 보였다. 500, 1,000 ㎍/㎖의 경우 125 ㎍/㎖에 비해 유의하게 감소하였음을 관찰할 수 있었는데(Table 11, Fig. 10), 이러한 결과는 배양 시간이나 농도에 따른 SOD 활성 감소가 이전에 보고되었던 다른 천연물의 결과와도 비슷한 양상이었다27,28).

이러한 결과를 살펴보면 지모 추출물이 항산화 효과7,29)를 통하여 멜라닌 생성하며 억제하며, 자유라디칼의 생성과 활성을 억제하는 지모의 항산화 효능이 tyrosinase, TRP-2 및 MITF의 활성 억제30,31)와 연관된다고 사료된다.


결 론

이상으로 지모 추출물의 피부 미백효과 검증을 위해 B16F10 세포를 이용하여 tyrosinase 생성과 PCR 실험 및 3 종류의 항산화 활성도 실험을 진행하고, α-MSH를 이용한 melanin 생성의 전반적인 과정을 분석한 결과, 지모 추출물이 멜라닌생성 억제 및 항산화작용를 통한 피부 미백 효과를 나타냄을 알 수 있었다.

실험 중 몇몇 지표에서는 피부 미백효과를 인정받은 Arbutin과 비교해도 지모 추출물의 피부 미백 효과가 우수한 결과가 나타나고 있어, 이러한 자료들을 기반으로 지모를 활용한 더욱 심도 있는 연구를 진행하는 데 자료로 활용되고, 아울러 천연 기능성 원료로 개발하는데 있어서 유의하게 활용될 수 있을 것이라 생각된다.


Acknowledgments

이 논문은 동신대학교 학술연구비에 의하여 연구되었음


References
1. Jeon M. Enzymatic Production of Rhapontigenin and Its Application for Skin Whitening Agent, Graduate School of Knowledge-based Technology and Energy, Korea Polytechnic University. 2008.
2. Cho YJ. Characteristics of cosmetic with whitening compounds from Phellodendron amurense. J Appl Biol Chem. 2011;54:108-13.
3. Kim KY, Lee NK. Herbal Extracts Research Trend that have Effects on Melanin Production and Control. Kor J Aesthet Cosmetol. 2014;12(4):453-61.
4. Oh SJ, Mo JH. A Comparative Study on Bioactivity of Dried and Fermented Salicornia Herbacea Extracts as Cosmetics Materials. The Korean Society for Aesthetics and Cosmetology. 2011;9:305-12.
5. Herbology Editorial Committee of Korean Medicine Schools. Herbology. Seoul: Younglimsa; 2012. pp. 201-2.
6. Ewha University-Industry Collaboration Foundation. Isolation and quantitative analysis of bioactive components from Anemarrhenae Rhizoma and Angelicae Tenuissimae Radix. Seoul: Ewha University; 2009. p. 3.
7. Kim GS, Park CK, Seong JD, Kim HT, Han SI, and Kwack YH. Isolation and HPLC analysis of timosaponin A from rhizomes of Anemarrhena asphodeloides Bunge. Korean J Medicinal Crop Sci. 1999;7:45-50.
8. Sun XH, Kizu H, Tommory T. Quantitative analysis of timosaponin B-II, timosaponin A-III and mangferin in Anemarrhena rizoma and Kampo prescriptions containing this crdue drug. Shoyakugaku Zasshi. 1992;46:19-24.
9. Lee YJ, Song BR, Lee SL, Shin HS, Park SN. Antimicrobial, Antioxidant and Cellular Protective Effects against Oxidative Stress of Anemarrhena asphodeloides Bunge Extract and Fraction Microbiol. Biotechnol. Lett. 2018;46(4):360-71.
10. Park YJ, Ku CS, Kim MJ, Lee MK, Kim KO, Ryu HW, et al. Cosmetic Activities of Nyasol from the Rhizomes of Anemarrhena asphodeloide. J Appl Biol Chem. 2015; 58(1):31-8.
11. Kwon OJ, Lee HY, Kim TH, Kim SG. Antioxidant and pancreatic lipase inhibitory activities of Anemarrhena asphodeloides. Korean J Food Preserv. 2014;21(3):421-6.
12. Hosoi, J, Abe, E, Suda T, Kuroki T. Regulation of melanin synthesis of B16 mouse melanoma cells by 1α. 25-Dihydroxyvitamin D3 and Retinoic Acid. Cancer Res. 1985;45(4):1474-8.
13. Yagi, A, Kanbara, T, Morinobu, N. The effects of tyrosinase inhibition for aloe. Planta Med. 1986;3981:517-9.
14. Marklund S, Marklund G. Involvement of superoxide anion radical in the oxidation of pyrogallol and a convenient assay for superoxide dismutase. Eur. J. Biol. Chem. 1974;47:468-74.
15. Blois MS. Antioxidant determinations by the use of a stable free radical. Nature. 1958;181:1199-1200.
16. Kato H, Lee IE, Chuyen NV, Kim SB, Hayase F. Inhibition of nitrosamine formation by nondialyzable melanoidines. Agric Biol Chem, 1987;51:1333-8.
17. Korea Ministry of Government Legislation homepage: Regulation on the Examination of Functional Cosmetics. Available from: http://www.law.go.kr/행정규칙/기능성화장품%20심사에%20관한%20규정
18. Yoon HJ. Isolation and characterization of tyrosinase inhibitors from the stem bark of Broussonetia kazinoki Graduate School of Seoul National Univ. 2010.
19. Hakozaki T, Minwalla L, Zhuang J, Chhoa M, Mastubara A, Miyamoto Killebrand GG, et al. The effect of niacinamide on reducing cutaneous pigmentation and suppression of melanosome transfer. Br. J. Dermatol. 2002;147:20-31.
20. Kim MO. A Study of Skin Whitening Effect of Oxalistriangularis and Its Oil Soluble Active Compounds. Graduate School of Sookmyung Woman Univ. 2010.
21. Kim SM, Yoo DY. The effect of Mibaeksan(MB) on melanin synthesis and gene expression. J. Orient. Obstet. Gynecol. 2009;22(4):1-18.
22. Rescigno A, Sollai, F, Pisu, B, Rinaldi, A, Sanjust, E. Tyrosinase inhibition: General and applied aspects. J. Enzym. Inhib. Med. Chem. 2002;17(4):207-18.
23. Hearing VJ, Tsukamoto, K. Biochemical control of melanogenesis and melanosomal organization. J. Invest. Dermatol. 1999;4:24-8.
24. Jiménez-Cervantes C, Martínez-Esparza M., Pérez C, Daum, N, Solano, F, García-Borrón JC. Inhibition of melanogenesis in response to oxidative stress : transient downregulation of melanocyte differentiation markers and possible involvement of microphthalmia transcription factor. J. Cell Sci. 2001;114:2335-44.
25. Korea Ministry of Government Legislation homepage: Functional Cosmetic Standards and Test Methods. Available from: http://www.law.go.kr/행정규칙/기능성화장품기준및시험방법/(2018-111,20181226)
26. Park SN. Skin aging and antioxidant. J. Soc. Cosmet. Scientists Korea. 1997;23:75-132.
27. Cha EJ, Pyo MY, Yang KS, Kim AK. Effect of Phellinus Linteus Extract on the Activity of Antioxidant Enzyme Cancer Prevention Research 2008;13(4):311-5.
28. Kim AK, Cha EJ. Effect of pharbitis seed extract on the antioxidant enzyme activity in B16F10 murine melanoma cells by oxidative stress. The Pharmaceutical Society of Korea. 2004;48:93-8.
29. Beak GH, Cho SJ, Cho HJ, Hong GH, Kim HW, Cho SI. Effects of Anemarrhenae Rhizoma on anti-oxidative activites, Kor. J. Herbology. 2007;22(3):101-7.
30. Lee JY, Cho YR, Park JH, Ahn EK, Jeong W, Shin HS, Kim MS, Yang SH, Oh JS. Anti-melanogenic and anti-oxidant activities of ethanol extract of Kummerowia striata: Kummerowia striata regulate anti-melanogenic activity through down-regulation of TRP-1, TRP-2 and MITF expression. Toxicol Rep. 2018;3(6):10-7.
31. Jang TW, Park JH. Antioxidative Activities and Whitening Effects of Ethyl Acetate Fractions from The Immature Seeds of Abeliophyllum distichum. Journal of Life Science;2017:27(5):536-44.