The Society of Pathology in Korean Medicine
[ ORIGINAL ARTICLES ]
Journal of Physiology & Pathology in Korean Medicine - Vol. 39, No. 1, pp.8-14
ISSN: 1738-7698 (Print) 2288-2529 (Online)
Print publication date 25 Feb 2025
Received 13 Dec 2024 Revised 11 Feb 2025 Accepted 24 Feb 2025
DOI: https://doi.org/10.15188/kjopp.2025.02.39.1.8

반지련 추출물의 대식세포 이동 및 분화 조절을 통한 폐암세포 이동능 억제 효과

박신형*
동의대학교 한의과대학 병리학교실
Inhibitory Effect of Scutellaria barbata D. Don. Extract on Lung Cancer Cell Migration via Regulation of Macrophage Recruitment and Polarization
Shin-Hyung Park*
Department of Pathology, College of Korean Medicine, Dong-eui University

Correspondence to: *Shin-Hyung Park, Department of Pathology, College of Korean Medicine, Dong-eui University, 47227, YangJeong-ro, Busanjin-gu, Busan, Republic of Korea ·E-mail : omdpark@deu.ac.kr ·Tel : +82-51-890-3332

Ⓒ The Society of Pathology in Korean Medicine, The Physiological Society of Korean Medicine

Abstract

Scutellaria barbata D. Don has traditionally been used in Korean medicine for its anti-cancer properties. However, most studies on its anti-cancer effects have focused primarily on its direct actions on cancer cells. In this study, we aimed to explore the anti-cancer effects of the ethanolic extract of Scutellaria barbata D. Don (ESBD), with a particular focus on its regulatory impact on tumor-associated macrophages (TAMs). Our results showed that ESBD inhibited the migration of RAW 264.7 mouse macrophages toward conditioned medium (CM) derived from mouse Lewis lung carcinoma (LLC) cells, which suggests that ESBD might reduce macrophage infiltration into tumor sites. Furthermore, ESBD suppressed the IL-6-induced expression of M2 macrophage markers, including CD206, arginase-1, and IL-10, indicating that ESBD suppresses M2 macrophage polarization in RAW 264.7 cells. Additionally, ESBD decreased the phosphorylation of signal transducer and activator of transcription 3 (STAT3), a transcription factor activated by the IL-6 signaling pathway and associated with M2 polarization. Transwell migration assays further showed that CM from M2-polarized RAW 264.7 cells enhanced LLC cell migration, whereas CM from RAW 264.7 cells co-treated with ESBD and IL-6 significantly diminished LLC cell migration. In summary, our findings demonstrate that ESBD attenuates lung cancer cell migration by impairing macrophage recruitment and preventing M2 macrophage polarization.

Keywords:

Scutellaria barbata D. Don, Tumor-associated macrophage, M2 macrophage, STAT3, Cancer migration

서 론

대식세포는 말초 조직에 널리 분포하여 병원체에 대한 1차 방어선을 형성하는 역할을 한다. 지난 수십 년간 대식세포가 암을 진행시키는 데 필수적인 역할을 한다는 사실이 알려지면서 암을 치료하기 위해 대식세포를 조절하려는 전략이 새롭게 제안되고 있다1). 대식세포는 종양미세환경을 구성하는 기질세포 중 가장 높은 비율을 차지하고 있으며, 이들을 종양연관대식세포(tumor-associated macrophage, TAM)라고 지칭한다2). 혈중을 순환하는 단핵구가 종양에서 분비되는 각종 인자에 의해 TAM으로 분화되어 종양 조직에 축적되면 환자의 불량한 예후와 강하게 연관된 것으로 알려져 있다3). 일반적으로 TAM은 혈관신생 촉진, 적응 면역 억제, 세포외기질 재구조화 등을 통해 암을 촉진하는 효과를 나타낸다4). TAM이 종양으로 유인되는 과정은 암에서 C-C motif chemokine ligand 2 (CCL2), CCL5와 같은 인자가 분비되면서 발생하며, 종양에 침윤된 TAM은 다양한 성장인자, 종양 촉진인자, 케모카인(chemokine), 사이토카인(cytokine) 등을 분비하여 암을 악화시킨다5,6).

TAM은 종양미세환경 내 특정 인자들에 의해 크게 M1형 대식세포와 M2형 대식세포로 분극될 수 있다. M1형 분극은 종양괴사인자 알파(tumor necrosis factor-α, TNF-α), 인터페론 감마(interferon-γ, IFN-γ), toll양 수용체 리간드인 리포 다당류(lipopolysaccharide, LPS) 등에 의해 유도되며, M1형 대식세포는 염증성 사이토카인을 분비하고 면역 반응을 활성화하여 암세포를 제거하는 역할을 한다4,7). 반대로 M2형 분극은 인터루킨(interleukin, IL)-4, -6, -13 등에 의해 유도되며, arginase-1, IL-10, transforming growth factor-β (TGF-β) 등 Th2 반응을 촉진하는 사이토카인을 분비하기 때문에 염증 및 면역반응을 억제하고, 궁극적으로 암을 진행시키는 것으로 알려져 있다8,9). 한편 M2형 대식세포는 CD206, CD163, CD209와 같은 특정 표지자를 통해 확인할 수 있다4). 불행히도 종양에서 분비되는 각종 인자들은 이동성 단핵구를 종양 실질로 유인하여 TAM으로 분화시키며, TAM은 대부분 M2형 대식세포와 유사한 특성을 나타낸다1,10-12). M2형 TAM은 VEGF 신호전달경로를 활성화하여 혈관신생을 촉진하며, 면역세포 활성화를 억제하여 혈류 속에서 이동하는 암세포를 보호한다4,11,13). 또한, MMP와 같은 효소를 분비하여 세포외기질을 재구성함으로써 암세포의 이동을 용이하게 하고, TGF-β를 분비하여 암세포의 상피중간엽이행(epithelial-mesenchymal transition, EMT)을 촉진한다4,14). 그뿐 아니라 전이가 발생하는 부위에 먼저 도달하여 전이성틈새(pre-metastatic niche)를 형성함으로써 암세포가 새로운 장기에 안정적으로 정착하고 성장할 수 있도록 돕는다15). M2형 대식세포의 상기한 모든 특성들은 암세포의 전이를 촉진하는 데 기여하므로 TAM은 암 전이를 억제하기 위한 유망한 타겟이 될 수 있다. 이에 대식세포의 종양 내 침윤과 M2형 분극을 억제하는 한편 M1형 분극을 촉진하는 전략이 새로운 암 치료 전략으로 제안되고 있다16).

반지련(半枝蓮)은 꿀풀과에 속한 일년생 혹은 다년색 초본인 칫솔골무꽃 Scutellaria barbata D. Don의 전초(全草)이다17). 전통적인 효능으로서 소종해독(消腫解毒)시켜 각종 상처나 종기를 치료하는 데 사용되었으며, 특히 항암효과를 가져 한방 암 치료에 중요한 약재로 활용되어 왔다17). 반지련은 다양한 생리활성을 가진 천연 화합물들을 함유하고 있으며, 주요성분으로서 luteolin, scutellarin, quercetin, apigenin, wogonin 등 플라보노이드와 neo-clerodane diterpenoid 및 각종 다당류 등을 포함하고 있다18). 최근 약리학적 연구 결과 반지련은 암세포의 세포증식을 억제하고 아폽토시스(apoptosis)를 유도하며, 이동능과 침윤능 및 EMT를 억제하여 전이를 감소시키고, 혈관 신생을 억제하여 항암효과를 나타내는 것으로 보고되었다18). 그러나 현재까지 반지련이 TAM 조절에 미치는 영향은 전혀 연구된 바가 없다. 본 연구에서는 반지련 에탄올 추출물이 대식세포 유인 및 M2형 분극에 미치는 영향과 그로 인해 암세포 전이에 미치는 효과를 조사하여 유의한 결과를 얻었기에 보고하는 바이다.


재료 및 방법

1. 시료 제조

반지련은 ㈜본초마루(Seoul, Korea)에서 구입하였다. 먼저 반지련 50g을 잘게 파쇄한 후 80% 에탄올 1500 ㎖를 넣고 초음파세척기에서 20분씩 3회 sonication 하였다. 그 후 shaking incubator를 이용하여 40℃에서 120 rpm으로 교반시키며 72시간 동안 추출하였다. 1차 추출액을 모은 후 동일한 방식으로 24시간 동안 2차 추출하였다. 1차 및 2차 추출액을 모아 3000 rpm에서 20분간 원심분리하고 상층액을 모아 여과시킨 후 감압농축 및 동결건조하였다. 그 결과 총 8.07 g의 추출 분말을 얻어(수율 16.14%) dimethylsulfoxide(DMSO; Amresco, Solon, OH, USA)에 100 ㎎/㎖로 녹여 실험에 사용하였다. 이를 ESBD(ethanolic extract of Scutellaria barbata D. Don)로 명명하였다.

2. 세포 배양

RAW 264.7 마우스 대식세포는 동의대학교 최영현 교수님으로부터 분양받았고, Lewis lung carcinoma(LLC) 마우스 폐암세포주는 부산대학교 하기태 교수님으로부터 분양받았다. LLC 세포는 RPMI-1640(WelGENE, Seoul, Korea) 배지 500 ㎖에 fatal bovine serum(FBS; WelGENE) 50 ㎖과 penicillin-streptomycin(WelGENE) 5 ㎖을 첨가하여 사용하였으며, RAW 264.7 세포는 DMEM(WelGENE) 배지 500 ㎖에 상기한 방식으로 FBS와 항생제를 첨가하여 배양하였다. 세포는 37℃, 5% CO2 조건에서 배양하였다.

3. MTT assay

RAW 264.7 세포를 96 well plate에 well 당 1×104개 분주하고 하루 동안 안정화시켰다. 이후 ESBD를 농도별(0-100 ㎍/㎖)로 처리하였다. 24시간 후, 세포배양액에 MTT 시약(Duchefa, Haarlem, The Netherlands)을 0.4 ㎎/㎖ 농도로 첨가하고, 37℃에서 2시간 동안 배양하였다. 배양 후 각 well의 세포배양액을 제거한 뒤 DMSO 100 ㎕를 첨가하고 20분간 교반하여 formazin을 완전히 용해시켰다. 마지막으로 microplate reader (Molecular Devices, Sunnyvale, CA, USA)를 사용하여 540nm에서 흡광도를 측정하고, 이를 통해 세포 생존율을 계산하였다.

4. 세포배양액(conditioned medium, CM) 준비

Transwell assay에 chemoattractant로 사용하기 위해 CM을 아래와 같은 방식으로 준비하였다. 먼저 LLC 세포의 CM을 모으기 위해 LLC 세포를 100 π dish에 분주하여 가득 찰 때까지 배양한 다음 세포배양액을 제거하고 serum이 포함되지 않은 RPMI-1640 배지 5 ㎖을 넣어주었다. 24시간 배양 후 세포배양액을 모아 3000 rpm에 5분간 원심분리하여 상층액만 취한 것을 CM으로 사용하였다. 다음으로 RAW 264.7 세포의 CM을 모으기 위해 RAW 264.7 세포를 100 π dish에 분주하고 세포밀집도가 70%가 될 때까지 배양한 다음 IL-6(100 ng/㎖)와 ESBD(100 ㎍/㎖)를 동시에 처리하였다. 24시간 배양 후 세포배양액을 제거하고 serum이 포함되지 않은 DMEM 배지 5 ㎖을 넣어 또다시 24시간 동안 배양하였다. 그 후 세포배양액을 상기한 방식으로 원심분리하여 상층액을 CM으로 사용하였다.

5. Transwell assay

Transwell assay를 위해 8.0 ㎛ pore size의 24 well transwell plate(Corning, NY, USA)를 사용하였다. 먼저 insert의 outer membrane 부분을 0.1% gelatin(Sciencell, Carlsbad, CA, USA)으로 코팅하여 굳힌 후 RAW 264.7 세포(3×105개)를 serum이 포함되지 않은 DMEM 배지 200 ㎖에 현탁하여 insert에 분주하면서 ESBD를 농도별(0, 25, 50, 100 ㎍/ ㎖)로 처리하였다. Bottom chamber에는 LLC 세포로부터 모은 CM을 500 ㎕ 분주하여 chemoattractant로 사용하였다. 24시간 배양 후 insert를 methanol로 5분간 고정하고, hematoxylin(Sigma‐Aldrich)으로 30분간 염색하였다. 그 후 insert 안쪽을 면봉으로 닦아내고 증류수에 수차례 세척한 후 intermembrane을 분리하여 mounting하고 현미경(Carl Zeiss, Oberkochen, Germany)으로 염색된 세포(이동한 세포)의 수를 계수하였다. 한편 ESBD가 대식세포의 M2형 분극을 조절하여 폐암세포의 이동능을 감소시킬 수 있는지 확인하기 위하여 역시 transwell assay를 시행하였다. 먼저 insert에는 serum이 없는 RPMI-1640 배지 200 ㎖에 현탁된 LLC 세포를 3×105개 분주하였고, bottom chamber에는 RAW 264.7 세포로부터 모은 CM을 500 ㎕ 분주하였다. 24시간 배양 후 이동한 LLC 세포를 상기한 방식으로 염색하고 계수하였다.

6. Real-time polymerase chain reaction(PCR)

RAW 264.7 세포를 6 well plate에 5×105개 분주하여 하루 동안 안정화시킨 후 100 ng/㎖ IL-6(PeproTech, Rocky Hill, NJ, USA)와 ESBD(0, 50, 100 ㎍/㎖)를 동시에 처리하였다. 24시간 배양 후 TRIzol reagent(Invitrogen Co., Carlsbad, CA, USA)를 이용하여 RNA를 분리하였고, RNA 1 μg을 CellScript All-in-One 5X First Strand cDNA Synthesis Master Mix(CellSafe, Yongin, Korea)를 사용하여 cDNA로 합성하였다. cDNA를 nuclease-free water에 1:20으로 희석한 후 primer 및 SYBR green(Enzynomics, Daejeon, Korea)을 넣고 CFX Connect Real-Time PCR Detection System(Bio-Rad Laboratories, Hercules, CA, USA)을 이용하여 real-time PCR 분석을 시행하였다. 사용한 primer 서열과 annealing temperature는 Table 1과 같다.

Primer sequence and annealing temperature

7. 웨스턴블롯

RAW 264.7 세포를 6 well plate에 5×105개 분주하여 하루 동안 안정화시킨 후 IL-6(100 ng/㎖)와 ESBD(0, 50, 100 ㎍/㎖)를 동시에 처리하고, 24시간 동안 배양하였다. 그 후 RIPA buffer(Thermo Fisher Scientific, San Jose, CA, USA)를 사용하여 세포로부터 단백질을 추출한 뒤, Bicinchoninic acid protein assay kit(Pierce Biotechnology, Rockford, IL, USA)를 사용하여 단백질 농도를 정량하였다. 8% acrylamide gel을 제조한 후, 각 lane에 20 ㎍의 단백질을 loading하여 SDS-PAGE를 통해 전기영동하였다. 단백질을 PVDF 멤브레인(Millipore Corporation, Bedford, MA)으로 transfer하고 3% bovine serum albumin(BSA, GenDEPOT, TX, USA)으로 실온에서 30분간 blocking 하였다. 그 후 1차 항체를 3% BSA 용액으로 1:1000 희석하여 멤브레인과 4℃에서 overnight 반응시켰다. 다음 날, 멤브레인을 Tris-buffered saline with Tween® 20(TBST)로 수차례 세척한 뒤 2차 항체를 3% skim milk로 1:10000 희석하여 실온에서 1시간 동안 멤브레인과 반응시켰다. 또다시 TBST로 멤브레인을 수차례 세척한 후 D-Plus ECL Femto System(Donginbio, Seoul, Korea)을 이용하여 단백질 발현을 검출하고, 발현 수준을 분석하였다. Phosphorylated signal transducer and activator of transcription 3 (STAT3; Y705) 및 total STAT3 항체는 Cell Signaling Technology (Beverly, MA, USA)에서 구입하였고, actin 항체는 Santa Cruz Biotechnology Inc. (Santa Cruz, CA, USA)에서 구입하였다. Goat anti‑rabbit 2차 항체는 Enzo Life Sciences (Farmingdale, NY, USA)에서 구입하였다.

8. 통계 분석

모든 실험 결과는 평균(mean)±표준편차(SD)로 표시하였으며, Student’s t-test를 이용하여 P < 0.05인 것을 통계적으로 유의성 있다고 판단하였다.


결 과

1. 대식세포 증식에 영향을 미치지 않는 ESBD 농도 설정

먼저 대식세포의 증식에 영향을 미치지 않는 농도를 설정하기 위하여 RAW 264.7 세포에 ESBD를 농도별(0, 5, 10, 25, 50, 100 ㎍/㎖)로 24시간 처리한 후 MTT assay를 통해 세포생존율을 측정하였다. 그 결과 ESBD는 저농도(5, 10 ㎍/㎖)에서 RAW 264.7 세포의 증식을 다소 촉진하는 경향을 보였으며, 25-100 ㎍/㎖에서는 세포증식에 유의한 영향을 미치지 않는 것으로 나타났다(Fig. 1). 따라서 100 ㎍/㎖을 ESBD의 최고농도로 설정하여 이후 실험을 진행하였다.

Fig. 1.

Effects of ESBD on the cell viability of RAW 264.7 cells. RAW 264.7 mouse macrophages were treated with ESBD for 24 h. Cell viability was assessed using the MTT assay. Data are presented as the mean ± SD of three independent experiments. Statistical significance was evaluated using the Student’s t-test (ns, not significant; * P < 0.05, ** P < 0.01 versus untreated control). ESBD, ethanolic extract of Scutellaria barbata D. Don.

2. ESBD가 대식세포 이동능에 미치는 영향

대식세포는 암세포가 분비하는 다양한 인자에 의해 종양 실질로 유인되어 TAM으로 분화한다3). TAM은 암의 성장과 전이를 촉진하므로 대식세포의 종양 내 침윤을 억제하려는 전략이 새롭게 제안되고 있다16). 이에 대식세포가 종양으로 이동하는 능력을 ESBD가 조절할 수 있는지 transwell assay로 조사하고자 하였다. 암세포가 대식세포를 유인하는 과정을 mimic하기 위해 bottom chamber에는 LLC 폐암세포로부터 모은 CM을 넣고, insert에는 RAW 264.7 세포를 분주하면서 ESBD를 농도별(0, 25, 50, 100 ㎍/㎖)로 처리하였다(Fig. 2A). 24시간 후 대식세포의 이동능을 확인한 결과 ESBD 처리에 의해 농도의존적으로 RAW 264.7 세포의 이동능이 현저하게 감소하는 것을 확인하였다(Fig. 2B and 2C). 대조군에 비해 ESBD 25 ㎍/㎖ 처리군에서는 62.89±3.15%, 50 ㎍/㎖ 처리군에서는 46.57±1.79%, 100 ㎍/㎖ 처리군에서는 41.22±2.63%로 대식세포의 이동능이 각각 감소하였다. 이러한 결과는 암세포가 분비하는 다양한 인자들에 의해 대식세포가 종양으로 유인되는 것을 ESBD가 억제할 수 있음을 시사한다.

Fig. 2.

Effects of ESBD on the migration of RAW 264.7 cells toward cancer cells. (A) The experimental design of the transwell assay is shown. RAW 264.7 mouse macrophages were seeded into the inserts of a transwell plate and treated with ESBD for 24 h. Conditioned medium (CM) collected from LLC cells was added to the bottom chamber. (B) Migrated RAW 264.7 cells were stained and observed under a microscope at ×100 magnification (scale bar = 100 μm). (C) Relative migration was quantified by counting the migrated RAW 264.7 cells. Data are presented as the mean ± SD of three independent experiments. Statistical significance was determined using the Student’s t-test (*** P < 0.001 versus untreated control). ESBD, ethanolic extract of Scutellaria barbata D. Don; LLC, Lewis lung carcinoma.

3. ESBD가 대식세포의 M2형 분극에 미치는 영향

종양 내 TAM이 종양미세환경에서 분비되는 다양한 인자에 의해 M2형 대식세포로 분화되면 암세포의 EMT 및 혈관신생을 촉진하고 면역작용을 억제하므로 대식세포의 M2형 분극을 억제하려는 전략이 각광받고 있다4). 이에 ESBD가 대식세포의 M2형 분극에 미치는 영향을 조사하고자 하였다. RAW 264.7 세포에 M2형 분극을 유도할 수 있는 대표적인 사이토카인인 IL-6(100 ng/㎖)와 ESBD(50, 100 ㎍/㎖)를 동시에 처리한 후 24시간 후에 real-time PCR로 M2 대식세포 마커인 CD206, arginase-1, IL-10의 mRNA 발현을 확인하였다. 그 결과 CD206 발현은 IL-6 처리에 의해 4.73±1.21배 증가했다가 ESBD 50 ㎍/㎖, 100 ㎍/㎖ 처리에 의해 각각 0.78±0.09배, 0.49±0.21배로 현저하게 감소하였다(Fig. 3A). 또한, arginase-1 발현은 IL-6 처리에 의해 2.72±0.3배 증가했다가 ESBD 50 ㎍/㎖, 100 ㎍/㎖ 처리에 의해 각각 2.59±0.21배, 1.61±0.23배로 감소하였다(Fig. 3B). 마지막으로 IL-10 발현은 IL-6 처리에 의해 16.9±1.05배 증가했다가 ESBD 50 ㎍/㎖, 100 ㎍/㎖ 처리에 의해 각각 4.98±2.58배, 2.89±1.74배로 유의하게 감소하였다(Fig. 3C). 이러한 결과는 ESBD가 대식세포의 M2형 분극을 효과적으로 억제할 수 있음을 시사한다.

Fig. 3.

Effects of ESBD on the expression of M2 macrophage marker genes in RAW 264.7 cells. RAW 264.7 mouse macrophages were stimulated with IL-6 (100 ng/ml) w/ or w/o ESBD. After 24 h, the mRNA levels of M2 marker genes, including CD206 (A), arginase-1 (B), and IL-10 (C), were measured using real-time PCR. Data are presented as the mean ± SD of three independent experiments. Statistical significance was evaluated using the Student’s t-test (## P < 0.01, ### P < 0.001 versus untreated control; ns, not significant, ** P < 0.01, *** P < 0.001 versus cells treated with IL-6). ESBD, ethanolic extract of Scutellaria barbata D. Don; IL-6, interleukin-6.

4. ESBD가 대식세포의 STAT3 인산화에 미치는 영향

IL-6는 IL-6 receptor(IL6R)/glycoprotein 130(GP130)/Janus kinase(JAK) 신호전달경로를 통해 STAT3를 활성화하여 대식세포의 M2형 분극을 유도하는 것으로 알려져 있다19). 이에 ESBD가 IL-6로 유도한 STAT3의 인산화를 조절할 수 있는지 웨스턴블롯으로 확인하고자 하였다. 그 결과 RAW 264.7 세포에 IL-6(100 ng/㎖)를 처리하자 STAT3 인산화가 대조군에 비해 현저하게 증가하였고, ESBD 50 ㎍/㎖, 100 ㎍/㎖ 처리에 의해 유의하게 감소하는 것을 확인할 수 있었다(Fig. 4A and 4B). 이러한 결과는 ESBD가 STAT3 활성을 억제함으로써 대식세포의 M2형 분극을 저해할 수 있음을 시사한다.

Fig. 4.

Effects of ESBD on STAT3 phosphorylation in RAW 264.7 cells. RAW 264.7 mouse macrophages were stimulated with IL-6 (100 ng/mL) w/ or w/o ESBD. After 24 h, the levels of phosphorylated and total STAT3 were detected using Western blot analysis. Actin served as an internal control. (A) Representative blot images from three independent experiments are shown. (B) The ratio of phosphorylated to total STAT3 was calculated by quantifying band intensity. Data are presented as the mean ± SD of three independent experiments. Statistical significance was evaluated using the Student’s t-test (## P < 0.01 versus untreated control; * P < 0.05, ** P < 0.01 versus cells treated with IL-6). ESBD, ethanolic extract of Scutellaria barbata D. Don; IL-6, interleukin-6; STAT3, signal transducer and activator of transcription 3.

5. ESBD가 M2형 대식세포로 유도한 폐암세포의 이동능에 미치는 영향

M2형 대식세포는 혈관신생 촉진, 세포외기질 리모델링, EMT 촉진 및 전이성틈새 형성 등을 통해 암 전이를 유도하는 것으로 알려져 있다13-15). 이에 ESBD가 M2형 대식세포에 의해 증가한 폐암세포의 이동능을 조절할 수 있는지 transwell assay를 통해 확인하였다. 먼저 RAW 264.7 세포에 IL-6(100 ng/㎖)와 ESBD(100 ㎍/㎖)를 처리한 후 CM을 모아 bottom chamber에 분주하여 chemoattractant로 사용하였고, insert에는 LLC 폐암세포를 분주하여 24시간 동안 이동한 세포의 수를 확인하였다(Fig. 5A). 그 결과 IL-6를 처리한 RAW 264.7 세포의 CM은 LLC 세포의 이동을 촉진하여 아무것도 처리하지 않은 RAW 264.7 CM에 비해 세포 이동능을 137.11±4.63%만큼 증가시켰다. 그러나 IL-6와 ESBD를 동시 처리한 RAW 264.7 세포의 CM은 LLC 세포의 이동능을 88.58±8.19%로 다시 현저하게 감소시켰다(Fig. 5B and 5C). 상기한 결과는 IL-6 처리에 의해 M2형으로 분극한 대식세포가 암세포의 이동능을 촉진하나, IL-6와 ESBD를 동시 처리 시 M2형 분극이 억제됨으로써 암세포의 이동능 증가를 저해할 수 있음을 시사한다.

Fig. 5.

Effects of ESBD on the M2 macrophage-stimulated cancer cell migration. (A) Experimental schemes are shown. The conditioned medium (CM) collected from RAW 264.7 cells pretreated with IL-6 (100 ng/ml) w/ or w/o ESBD (100 μg/ml) for 24 h was added to the bottom chamber. LLC cells were seeded into the inserts and incubated for migration for 24 h. (B) Migrated LLC cells were stained and observed under a microscope at ×100 magnification (scale bar = 100 μm). (C) Relative migration was quantified by counting the migrated LLC cells. Data are presented as the mean ± SD of three independent experiments. Statistical significance was evaluated using the Student’s t-test (** P < 0.01, *** P < 0.001 versus respective control). ESBD, ethanolic extract of Scutellaria barbata D. Don; IL-6, interleukin-6; LLC, Lewis lung carcinoma.


고 찰

본 연구는 항암효과를 가지는 대표적 한약재로서 특히 중의(中醫) 임상에서 폐암 치료에 널리 빈용하고 있는 반지련의 항암효과를 대식세포 조절에 초점을 맞추어 조사한 연구이다. 그동안 반지련의 항암효과는 암세포 세포사멸 유도, 세포주기 조절, 이동능 및 침윤능 억제 등 암세포 자체 조절을 위주로 기전이 밝혀져 왔으며, 종양 미세환경 조절에 대한 연구는 상대적으로 부족하였다18). 따라서 본 연구에서는 종양 미세환경을 구성하는 대표적인 기질 세포인 대식세포 조절에 초점을 맞추어 반지련의 항암효과를 확인하고자 하였다.

본 연구의 주된 연구결과 및 시사점은 아래와 같다. 첫째, 암세포를 향해 대식세포가 이동하는 능력을 transwell assay를 통해 파악한 결과, ESBD는 농도의존적으로 대식세포의 이동능을 현저하게 억제하는 것을 확인할 수 있었다. 이는 암세포가 분비하는 다양한 인자들로 인해 대식세포가 종양이 위치한 곳으로 유인되어 TAM으로 분화하는 과정을 ESBD가 억제할 수 있음을 시사하는 것이다. 이와 연관된 기존 연구 결과로서 반지련은 면역 억제 작용을 하는 Treg 및 Th17 세포의 종양 내 침윤을 억제하였다20). 종양 실질에 침윤된 면역세포들이 암세포와 활발한 상호작용을 통해 암의 성장과 전이를 촉진한다는 점에 미루어 반지련은 대식세포, Treg, Th17 등 면역세포의 유인과 침윤을 억제함으로써 항암효과를 가질 것으로 사료된다. 둘째, 대식세포의 M2형 분극에 미치는 영향을 real-time PCR 기법으로 확인한 결과, ESBD는 IL-6로 유도한 M2형 대식세포 마커의 발현을 현저하게 감소시키는 효과가 있었다. M2형 대식세포 마커 중 CD206은 병원체 및 당단백질을 인식하고 내포하는 역할을 하며, 조직 손상을 복구하고 염증을 억제하는 면역 조절 역할을 담당한다21). Arginase-1은 L-arginine을 L-ornithine과 요소로 대사하는 효소로서 조직 복구 및 세포 성장을 지원하고, 염증반응을 억제하여 면역 억제 기능을 나타낸다22). IL-10은 강력한 항염증성 사이토카인으로 T세포 및 대식세포의 과도한 염증반응을 억제하고 조직 치유를 촉진하는데, 특히 이 과정에서 STAT3가 핵심 역할을 하는 것으로 알려져 있다23). ESBD는 이러한 마커들의 발현을 공히 억제하였으므로 대식세포의 M2형 분극 저해 효과가 있는 것으로 사료된다. 기존 연구에서도 반지련이 IL-10, TGF-β, IL-17A와 같은 면역 억제성 사이토카인의 분비를 감소시키고, IL-2 및 IFN-γ와 같은 면역 촉진성 사이토카인 분비를 증가시킴을 보고하였다20). 이러한 결과들을 종합적으로 고찰해보면 반지련이 면역 억제성 종양 미세환경에서 면역 촉진성 종양 미세환경으로의 변화를 유도하여 항암효과를 나타낼 것임을 시사한다. 셋째, M2형 대식세포는 MMP 등을 분비하여 세포외기질을 재구성함으로써 암세포의 이동을 촉진하고, TGF-β를 분비하여 암세포의 EMT를 촉진함으로써 전이를 일으키는 것으로 알려져 있으므로 ESBD는 M2형 분극 조절을 통해 암 전이를 억제할 가능성이 크다4,14). 특히 M2형 대식세포에서 분비되는 agrinase-1과 IL-10은 암세포의 이동능을 직접적으로 촉진시키는 인자로도 보고되어 있다24,25). 이에 대식세포를 M2형으로 분극시킨 후 transwell assay를 통해 암세포의 이동능에 대한 조절효과를 확인한 결과, ESBD는 M2형 대식세포가 유도한 폐암세포의 이동능 증가를 현저하게 억제하였다. 즉, ESBD의 M2형 분극 억제 효과가 면역조절 작용뿐만 아니라 직접적으로 암세포의 전이를 억제하여 항암효과를 나타냄을 시사한다.

본 연구의 상기한 시사점에도 불구하고 ESBD의 어떤 성분이 대식세포 조절작용을 나타내는지에 대해서 추후 연구가 필요하다. 반지련에는 약 300여종의 성분이 포함된 것으로 알려져 있다18). 반지련의 주요 활성 성분인 플라보노이드에는 quercetin, luteolin, scutellarein, scutellarin, wogonin, baicalein 등이 대표적으로 포함되어 있다26). 이 중 luteolin은 ESBD와 마찬가지로 대식세포의 M2형 분극을 억제하고 단핵구 유인을 저해하는 것으로 보고되어 ESBD의 활성을 매개하는 성분일 가능성이 높다27). 또한, baicalein도 대식세포의 M2형 분극 억제를 통해 유방암세포의 EMT를 저해하고 폐 전이를 감소시킴이 보고 되었으며28), wogonin 역시 대식세포를 M1형으로 분극시켜 암세포 사멸을 일으킨다고 알려져 있다29). 반지련에 포함된 terpenoid인 neo-clerodane diterpenoids 역시 면역조절 작용과 항암 활성을 가진 것으로 알려져 이들이 ESBD의 활성을 매개할 가능성도 존재한다30). 상기한 연구 결과들을 종합하면 ESBD가 대식세포를 조절하여 항암효과를 나타내는 것은 단일 성분의 작용이라기보다 다양한 성분들의 복합적인 상호작용 결과라고 보는 것이 합당하다. 다만 이러한 성분 간 복잡한 상호작용은 최근 각광받고 있는 네트워크 약리학과 같은 거시적 연구방법론을 도입함으로써 구체적 분석이 가능할 것으로 사료되며, 향후 많은 시간과 노력이 요구된다.


결 론

본 연구에서는 반지련 에탄올 추출물(ESBD)의 TAM 조절작용을 조사한 결과 다음과 같은 결론을 얻었다. ESBD는 암세포가 분비하는 다양한 인자로 인해 대식세포가 암세포로 적극적으로 유인되어 이동하는 것을 농도의존적으로 저해하였다. 또한 ESBD는 대식세포의 M2형 분극을 억제하는 데 탁월한 효과를 보였으며, 이는 STAT3의 인산화 억제를 통해 매개되었다. 마지막으로 ESBD는 M2형 대식세포로 유도한 암세포의 이동능 증가를 억제함으로써 대식세포 조절작용이 직접적인 항암효과를 가짐을 보여주었다, 종합하면, 상기한 연구 결과들은 반지련이 대식세포의 종양 내 침윤과 M2형 분극을 억제함으로써 암의 전이를 저해할 수 있는 가능성을 시사한다.

References

  • Franklin RA, Li MO. Ontogeny of Tumor-associated Macrophages and Its Implication in Cancer Regulation. Trends Cancer. 2016;2(1):20-34. [https://doi.org/10.1016/j.trecan.2015.11.004]
  • Almatroodi SA, McDonald CF, Darby IA, Pouniotis DS. Characterization of M1/M2 tumour-associated macrophages (TAMs) and Th1/Th2 cytokine profiles in patients with NSCLC. Cancer Microenviron. 2016;9(1):1-11. [https://doi.org/10.1007/s12307-015-0174-x]
  • Noy R, Pollard JW. Tumor-associated macrophages: from mechanisms to therapy. Immunity. 2014;41(1):49-61. [https://doi.org/10.1016/j.immuni.2014.06.010]
  • Zhang J, Zhou X, Hao H. Macrophage phenotype-switching in cancer. Eur. J. Pharmacol. 2022;931:175229. [https://doi.org/10.1016/j.ejphar.2022.175229]
  • Mantovani A, Allavena P, Sica A, Balkwill F. Cancer-related inflammation. Nature. 2008;454(7203):436-44. [https://doi.org/10.1038/nature07205]
  • Allavena P, Signorelli M, Chieppa M, Erba E, Bianchi G, Marchesi F, Olimpio CO, Bonardi C, Garbi A, Lissoni A, de Braud F, Jimeno J, D'Incalci M. Anti-inflammatory properties of the novel antitumor agent yondelis (trabectedin): inhibition of macrophage differentiation and cytokine production. Cancer Res. 2005;65(7):2964-971. [https://doi.org/10.1158/0008-5472.CAN-04-4037]
  • Naito M. Macrophage differentiation and function in health and disease. Pathol. Int. 2008;58(3):143-55. [https://doi.org/10.1111/j.1440-1827.2007.02203.x]
  • Labonte AC, Tosello-Trampont AC, Hahn YS. The role of macrophage polarization in infectious and inflammatory diseases. Mol. Cells. 2014;37(4):275-85. [https://doi.org/10.14348/molcells.2014.2374]
  • Mosser DM, Edwards JP. Exploring the full spectrum of macrophage activation. Nat. Rev. Immunol. 2008;8(12):958-69. [https://doi.org/10.1038/nri2448]
  • Ostuni R, Kratochvill F, Murray PJ, Natoli G. Macrophages and cancer: from mechanisms to therapeutic implications. Trends Immunol. 2015;36(4):229-39. [https://doi.org/10.1016/j.it.2015.02.004]
  • Qian BZ, Pollard JW. Macrophage diversity enhances tumor progression and metastasis. Cell. 2010;141(1):39-51. [https://doi.org/10.1016/j.cell.2010.03.014]
  • Solinas G, Germano G, Mantovani A, Allavena P. Tumor-associated macrophages (TAM) as major players of the cancer-related inflammation. J. Leukoc. Biol. 2009;86(5):1065-73. [https://doi.org/10.1189/jlb.0609385]
  • Martin JD, Fukumura D, Duda DG, Boucher Y, Jain RK. Reengineering the Tumor Microenvironment to Alleviate Hypoxia and Overcome Cancer Heterogeneity. Cold Spring Harb. Perspect. Med. 2016;6(12):a027094. [https://doi.org/10.1101/cshperspect.a027094]
  • Friedman-DeLuca M, Karagiannis GS, Condeelis JS, Oktay MH, Entenberg D. Macrophages in tumor cell migration and metastasis. Front. Immunol. 2024;15:1494462. [https://doi.org/10.3389/fimmu.2024.1494462]
  • Wang Y, Jia J, Wang F, Fang Y, Yang Y, Zhou Q, Yuan W, Gu X, Hu J, Yang S. Pre-metastatic niche: formation, characteristics and therapeutic implication. Signal Transduct. Target. Ther. 2024;9(1):236. [https://doi.org/10.1038/s41392-024-01937-7]
  • Ngambenjawong C, Gustafson HH, Pun SH. Progress in tumor-associated macrophage (TAM)-targeted therapeutics. Adv. Drug Deliv. Rev. 2017;114:206-21. [https://doi.org/10.1016/j.addr.2017.04.010]
  • The Jointly Published Textbook Compilation Committee of Oriental College of Medicine Nationwide Department. Herbology. Seoul: Younglim press; 2004. p.727.
  • Sun J, Cao Y, Liu Q, Zhou Z, Xu Y, Liu C. Chemical Constituents, Anti-Tumor Mechanisms, and Clinical Application: A Comprehensive Review on Scutellaria barbata. Molecules. 2024;29(17):4134. [https://doi.org/10.3390/molecules29174134]
  • Xia T, Zhang M, Lei W, Yang R, Fu S, Fan Z, Yang Y, Zhang T. Advances in the role of STAT3 in macrophage polarization. Front. Immunol. 2023;14:1160719. [https://doi.org/10.3389/fimmu.2023.1160719]
  • Gong B, Kao Y, Zhang C, Sun F, Zhao H. Systematic Investigation of Scutellariae Barbatae Herba for Treating Hepatocellular Carcinoma Based on Network Pharmacology. Evid. Based Complement. Alternat. Med. 2018;2018:4365739. [https://doi.org/10.1155/2018/4365739]
  • Lee SJ, Evers S, Roeder D, Parlow AF, Risteli J, Risteli L, et al. Mannose receptor-mediated regulation of serumglycoprotein homeostasis. Science. 2002;295(5561):1898-901. [https://doi.org/10.1126/science.1069540]
  • Vasquez-Dunddel D, Pan F, Zeng Q, Gorbounov M, Albesiano E, Fu J, et al. STAT3 regulates arginase-I in myeloid-derived suppressor cells from cancer patients. J. Clin. Invest. 2013;123(4):1580-9. [https://doi.org/10.1172/JCI60083]
  • Hutchins AP, Diez D, Miranda-Saavedra D. The IL-10/STAT3-mediated anti-inflammatory response: recent developments and future challenges. Brief Funct. Genomics. 2013;12(6):489-98. [https://doi.org/10.1093/bfgp/elt028]
  • Wang X, Xiang H, Toyoshima Y, Shen W, Shichi S, Nakamoto H, Kimura S, Sugiyama K, Homma S, Miyagi Y, Taketomi A, Kitamura H. Arginase-1 inhibition reduces migration ability and metastatic colonization of colon cancer cells. Cancer Metab. 2023;11(1):1. [https://doi.org/10.1186/s40170-022-00301-z]
  • Lane D, Matte I, Garde-Granger P, Bessette P, Piché A. Ascites IL-10 Promotes Ovarian Cancer Cell Migration. Cancer Microenviron. 2018;11(2-3):115-24. [https://doi.org/10.1007/s12307-018-0215-3]
  • Tang TT, Li SM, Pan BW, Xiao JW, Pang YX, Xie SX, Zhou Y, Yang J, Wei Y. Identification of Flavonoids from Scutellaria barbata D. Don as Inhibitors of HIV-1 and Cathepsin L Proteases and Their Structure-Activity Relationships. Molecules. 2023;28(11):4476. [https://doi.org/10.3390/molecules28114476]
  • Choi HJ, Choi HJ, Chung TW, Ha KT. Luteolin inhibits recruitment of monocytes and migration of Lewis lung carcinoma cells by suppressing chemokine (C-C motif) ligand 2 expression in tumor-associated macrophage. Biochem. Biophys. Res. Commun. 2016;470(1):101-6. [https://doi.org/10.1016/j.bbrc.2016.01.002]
  • Zhao X, Qu J, Liu X, Wang J, Ma X, Zhao X, Yang Q, Yan W, Zhao Z, Hui Y, Bai H, Zhang S. Baicalein suppress EMT of breast cancer by mediating tumor-associated macrophages polarization. Am. J. Cancer Res. 20181;8(8):1528-40.
  • Xiao Y, Zhang L, Zhu J, Zhang Y, Yang R, Yan J, Huang R, Zheng C, Xiao W, Huang C, Wang Y. Predicting the herbal medicine triggering innate anti-tumor immunity from a system pharmacology perspective. Biomed. Pharmacother. 2021;143:112105. [https://doi.org/10.1016/j.biopha.2021.112105]
  • Wang L, Chen W, Li M, Zhang F, Chen K, Chen W. A review of the ethnopharmacology, phytochemistry, pharmacology, and quality control of Scutellaria barbata D. Don. J. Ethnopharmacol. 2020;254:112260. [https://doi.org/10.1016/j.jep.2019.112260]

Fig. 1.

Fig. 1.
Effects of ESBD on the cell viability of RAW 264.7 cells. RAW 264.7 mouse macrophages were treated with ESBD for 24 h. Cell viability was assessed using the MTT assay. Data are presented as the mean ± SD of three independent experiments. Statistical significance was evaluated using the Student’s t-test (ns, not significant; * P < 0.05, ** P < 0.01 versus untreated control). ESBD, ethanolic extract of Scutellaria barbata D. Don.

Fig. 2.

Fig. 2.
Effects of ESBD on the migration of RAW 264.7 cells toward cancer cells. (A) The experimental design of the transwell assay is shown. RAW 264.7 mouse macrophages were seeded into the inserts of a transwell plate and treated with ESBD for 24 h. Conditioned medium (CM) collected from LLC cells was added to the bottom chamber. (B) Migrated RAW 264.7 cells were stained and observed under a microscope at ×100 magnification (scale bar = 100 μm). (C) Relative migration was quantified by counting the migrated RAW 264.7 cells. Data are presented as the mean ± SD of three independent experiments. Statistical significance was determined using the Student’s t-test (*** P < 0.001 versus untreated control). ESBD, ethanolic extract of Scutellaria barbata D. Don; LLC, Lewis lung carcinoma.

Fig. 3.

Fig. 3.
Effects of ESBD on the expression of M2 macrophage marker genes in RAW 264.7 cells. RAW 264.7 mouse macrophages were stimulated with IL-6 (100 ng/ml) w/ or w/o ESBD. After 24 h, the mRNA levels of M2 marker genes, including CD206 (A), arginase-1 (B), and IL-10 (C), were measured using real-time PCR. Data are presented as the mean ± SD of three independent experiments. Statistical significance was evaluated using the Student’s t-test (## P < 0.01, ### P < 0.001 versus untreated control; ns, not significant, ** P < 0.01, *** P < 0.001 versus cells treated with IL-6). ESBD, ethanolic extract of Scutellaria barbata D. Don; IL-6, interleukin-6.

Fig. 4.

Fig. 4.
Effects of ESBD on STAT3 phosphorylation in RAW 264.7 cells. RAW 264.7 mouse macrophages were stimulated with IL-6 (100 ng/mL) w/ or w/o ESBD. After 24 h, the levels of phosphorylated and total STAT3 were detected using Western blot analysis. Actin served as an internal control. (A) Representative blot images from three independent experiments are shown. (B) The ratio of phosphorylated to total STAT3 was calculated by quantifying band intensity. Data are presented as the mean ± SD of three independent experiments. Statistical significance was evaluated using the Student’s t-test (## P < 0.01 versus untreated control; * P < 0.05, ** P < 0.01 versus cells treated with IL-6). ESBD, ethanolic extract of Scutellaria barbata D. Don; IL-6, interleukin-6; STAT3, signal transducer and activator of transcription 3.

Fig. 5.

Fig. 5.
Effects of ESBD on the M2 macrophage-stimulated cancer cell migration. (A) Experimental schemes are shown. The conditioned medium (CM) collected from RAW 264.7 cells pretreated with IL-6 (100 ng/ml) w/ or w/o ESBD (100 μg/ml) for 24 h was added to the bottom chamber. LLC cells were seeded into the inserts and incubated for migration for 24 h. (B) Migrated LLC cells were stained and observed under a microscope at ×100 magnification (scale bar = 100 μm). (C) Relative migration was quantified by counting the migrated LLC cells. Data are presented as the mean ± SD of three independent experiments. Statistical significance was evaluated using the Student’s t-test (** P < 0.01, *** P < 0.001 versus respective control). ESBD, ethanolic extract of Scutellaria barbata D. Don; IL-6, interleukin-6; LLC, Lewis lung carcinoma.

Table 1.

Primer sequence and annealing temperature

Gene Sequence (5’→3’) Annealing temperature (℃)
arginase-1 F: AACCAGCTCTGGGAATCTGC
R: TCCATCACCTTGCCAATCCC
55
CD206 F: CTCTGTTCAGCTATTGGACG
R: CGGAATTTCTGGGATTCAGCTTC
55
IL-10 F: CTCTTACTGACTGGCATGAGGAT
R: GAGTCGGTTAGCAGTATGTTGT
55
GAPDH F: TACACTGAGGACCAGGTTGT
R: GTGGTCCAGGGTTTCTTACT
55